Mutagenetix > Incidental Mutation

Incidental Mutation 'R1675:Map1a'

187980

Institutional Source

Beutler Lab

Gene Symbol

Map1a

Ensembl Gene

ENSMUSG00000027254

Gene Name

microtubule-associated protein 1 A

Synonyms

Mtap1, Mtap-1, 6330416M19Rik, Mtap1a

MMRRC Submission

039711-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.415) question?

Stock #

R1675 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

121289600-121310832 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 121302655 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 1079 (C1079*)

Ref Sequence

ENSEMBL: ENSMUSP00000106269 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094639] [ENSMUST00000110639]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000094639
AA Change: C1317*

SMART Domains

Protein: ENSMUSP00000092223
Gene: ENSMUSG00000027254
AA Change: C1317*

Domain	Start	End	E-Value	Type
Blast:Lactamase_B	286	538	2e-54	BLAST
SCOP:d1eq1a_	584	699	8e-5	SMART
low complexity region	743	755	N/A	INTRINSIC
low complexity region	820	833	N/A	INTRINSIC
low complexity region	852	867	N/A	INTRINSIC
low complexity region	897	911	N/A	INTRINSIC
low complexity region	1228	1239	N/A	INTRINSIC
low complexity region	1334	1344	N/A	INTRINSIC
low complexity region	1540	1555	N/A	INTRINSIC
coiled coil region	1573	1602	N/A	INTRINSIC
internal_repeat_1	1616	1726	7.66e-6	PROSPERO
coiled coil region	1747	1771	N/A	INTRINSIC
internal_repeat_1	1774	1888	7.66e-6	PROSPERO
low complexity region	2060	2084	N/A	INTRINSIC
low complexity region	2121	2133	N/A	INTRINSIC
low complexity region	2156	2169	N/A	INTRINSIC
low complexity region	2383	2396	N/A	INTRINSIC
low complexity region	2436	2460	N/A	INTRINSIC
low complexity region	2517	2541	N/A	INTRINSIC
low complexity region	2589	2600	N/A	INTRINSIC
low complexity region	2662	2682	N/A	INTRINSIC
low complexity region	2685	2704	N/A	INTRINSIC
low complexity region	2716	2728	N/A	INTRINSIC
low complexity region	2766	2790	N/A	INTRINSIC
low complexity region	2980	2988	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000110639
AA Change: C1079*

SMART Domains

Protein: ENSMUSP00000106269
Gene: ENSMUSG00000027254
AA Change: C1079*

Domain	Start	End	E-Value	Type
Blast:Lactamase_B	48	300	3e-54	BLAST
SCOP:d1eq1a_	346	461	1e-4	SMART
low complexity region	505	517	N/A	INTRINSIC
low complexity region	582	595	N/A	INTRINSIC
low complexity region	614	629	N/A	INTRINSIC
low complexity region	659	673	N/A	INTRINSIC
low complexity region	990	1001	N/A	INTRINSIC
low complexity region	1096	1106	N/A	INTRINSIC
low complexity region	1302	1317	N/A	INTRINSIC
coiled coil region	1335	1364	N/A	INTRINSIC
internal_repeat_1	1378	1488	5.43e-6	PROSPERO
coiled coil region	1509	1533	N/A	INTRINSIC
internal_repeat_1	1536	1650	5.43e-6	PROSPERO
low complexity region	1822	1846	N/A	INTRINSIC
low complexity region	1883	1895	N/A	INTRINSIC
low complexity region	1918	1931	N/A	INTRINSIC
low complexity region	2145	2158	N/A	INTRINSIC
low complexity region	2198	2222	N/A	INTRINSIC
low complexity region	2279	2303	N/A	INTRINSIC
low complexity region	2351	2362	N/A	INTRINSIC
low complexity region	2424	2444	N/A	INTRINSIC
low complexity region	2447	2466	N/A	INTRINSIC
low complexity region	2478	2490	N/A	INTRINSIC
low complexity region	2528	2552	N/A	INTRINSIC
low complexity region	2742	2750	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133283

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.5%
20x: 93.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1A heavy chain and LC2 light chain. Expression of this gene is almost exclusively in the brain. Studies of the rat microtubule-associated protein 1A gene suggested a role in early events of spinal cord development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit Purkinje cell degeneration. Mice homozygous for a spontaneous mutation exhibit mild ataxia and Purkinje cell degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	C	T	1: 71,263,411		probably null	Het
Adam6b	T	C	12: 113,491,044	Y494H	probably benign	Het
Adamtsl2	GC	G	2: 27,082,485		probably null	Het
Anapc2	G	A	2: 25,272,639	V42M	possibly damaging	Het
Aph1a	T	A	3: 95,894,899	D64E	possibly damaging	Het
Arhgef11	C	T	3: 87,731,211	A1111V	possibly damaging	Het
Atoh1	T	C	6: 64,730,157	S279P	probably benign	Het
Atp10b	A	G	11: 43,225,648	T941A	probably damaging	Het
Barhl1	C	T	2: 28,915,411	R90Q	possibly damaging	Het
Calr3	T	C	8: 72,431,458	D91G	probably damaging	Het
Ccdc148	T	C	2: 58,980,554	D317G	probably damaging	Het
Cnn3	C	T	3: 121,457,169	Q19*	probably null	Het
Cul5	T	C	9: 53,646,683	D207G	probably benign	Het
Cyp4x1	T	C	4: 115,127,560	E41G	possibly damaging	Het
Dagla	T	A	19: 10,269,323	M138L	probably benign	Het
Dnah6	A	T	6: 73,129,540	M1738K	probably damaging	Het
Eif4enif1	T	A	11: 3,215,686	S88T	probably benign	Het
Eno3	T	C	11: 70,658,666		probably null	Het
Erbb3	C	A	10: 128,571,204	S1029I	probably damaging	Het
Erbin	C	A	13: 103,841,178	V624L	probably damaging	Het
Fam170b	C	T	14: 32,835,402	Q65*	probably null	Het
Fam208b	T	C	13: 3,569,507	I2241M	possibly damaging	Het
Gin1	T	A	1: 97,786,055	L360*	probably null	Het
Gldc	A	T	19: 30,143,453	D359E	probably damaging	Het
Gpr107	A	T	2: 31,167,051	T52S	possibly damaging	Het
Hip1r	A	G	5: 123,994,820	Y227C	probably damaging	Het
Hmgxb3	A	G	18: 61,135,559	L1004P	probably damaging	Het
Hspa1l	A	G	17: 34,977,443	N153D	probably damaging	Het
Itga8	C	A	2: 12,200,163	V488L	probably damaging	Het
Kcnk10	G	A	12: 98,496,288	A134V	probably benign	Het
Kif18a	T	A	2: 109,298,403	C406S	probably benign	Het
Klhl28	A	T	12: 64,951,819	S300R	probably damaging	Het
Kmt2e	C	T	5: 23,482,453	Q434*	probably null	Het
Lilrb4a	A	G	10: 51,496,185	T222A	probably benign	Het
Lipn	G	A	19: 34,080,710	R277Q	probably damaging	Het
Lrrc61	G	A	6: 48,568,774	R177Q	possibly damaging	Het
Lrrc74a	G	A	12: 86,741,026	E144K	probably damaging	Het
Mal	T	C	2: 127,635,044	Y77C	probably benign	Het
Mbd5	T	A	2: 49,256,218	S147T	possibly damaging	Het
Nsd2	T	A	5: 33,861,149	M509K	probably benign	Het
Olfr1342	C	T	4: 118,689,948	R168H	probably benign	Het
Olfr262	C	T	19: 12,240,831	V277I	probably benign	Het
Olfr414	T	C	1: 174,431,097	V223A	probably benign	Het
Olfr51	T	C	11: 51,007,637	F222L	probably benign	Het
Rcor2	C	T	19: 7,270,181	L45F	probably damaging	Het
Rpl12	T	A	2: 32,963,525	D107E	probably benign	Het
Rpl7l1	A	T	17: 46,778,191	F205I	probably damaging	Het
Samd4b	C	T	7: 28,414,010	G177R	probably damaging	Het
Sema4a	A	T	3: 88,454,766	F18I	possibly damaging	Het
Slc37a1	A	T	17: 31,338,074	T405S	probably damaging	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Syt14	T	C	1: 192,897,482	D781G	probably damaging	Het
Tprn	T	G	2: 25,264,409	D574E	probably benign	Het
Trim75	T	A	8: 64,982,511	E429V	probably damaging	Het
Trit1	C	T	4: 123,054,236	R450C	possibly damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Unc13c	A	G	9: 73,639,050		probably null	Het
Usp49	C	A	17: 47,673,410	L447I	probably damaging	Het
Vmn1r20	T	C	6: 57,431,952	C88R	probably benign	Het
Zfp94	T	A	7: 24,302,834	K394N	probably damaging	Het

Other mutations in Map1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00419:Map1a	APN	2	121299027	missense	probably damaging	0.99
IGL00826:Map1a	APN	2	121302276	missense	possibly damaging	0.87
IGL01476:Map1a	APN	2	121305207	missense	probably damaging	1.00
IGL02029:Map1a	APN	2	121303298	missense	possibly damaging	0.57
IGL02100:Map1a	APN	2	121302846	missense	probably damaging	0.99
IGL02136:Map1a	APN	2	121300212	missense	probably damaging	1.00
IGL02146:Map1a	APN	2	121299446	missense	probably damaging	1.00
IGL02264:Map1a	APN	2	121307313	missense	probably damaging	1.00
IGL02456:Map1a	APN	2	121298653	missense	probably damaging	1.00
IGL02485:Map1a	APN	2	121299288	missense	probably damaging	1.00
IGL02535:Map1a	APN	2	121302177	nonsense	probably null
IGL02628:Map1a	APN	2	121300104	missense	probably damaging	1.00
IGL02721:Map1a	APN	2	121304037	missense	probably benign	0.44
IGL03273:Map1a	APN	2	121300238	missense	probably damaging	1.00
IGL03281:Map1a	APN	2	121305060	missense	probably damaging	1.00
IGL02991:Map1a	UTSW	2	121301610	missense	probably damaging	0.99
R0096:Map1a	UTSW	2	121301505	missense	probably damaging	1.00
R0096:Map1a	UTSW	2	121301505	missense	probably damaging	1.00
R0218:Map1a	UTSW	2	121305425	missense	probably benign	0.00
R0363:Map1a	UTSW	2	121302044	missense	probably damaging	1.00
R0450:Map1a	UTSW	2	121305774	missense	probably benign	0.27
R0469:Map1a	UTSW	2	121305774	missense	probably benign	0.27
R0477:Map1a	UTSW	2	121302101	missense	probably damaging	1.00
R0504:Map1a	UTSW	2	121302941	missense	probably benign	0.03
R0510:Map1a	UTSW	2	121305774	missense	probably benign	0.27
R0521:Map1a	UTSW	2	121305753	missense	probably damaging	1.00
R0601:Map1a	UTSW	2	121298602	missense	probably damaging	1.00
R0619:Map1a	UTSW	2	121305255	missense	probably damaging	0.96
R0633:Map1a	UTSW	2	121308014	missense	probably damaging	1.00
R0652:Map1a	UTSW	2	121302783	missense	probably benign	0.04
R0893:Map1a	UTSW	2	121300533	missense	probably damaging	1.00
R0960:Map1a	UTSW	2	121301643	missense	probably benign	0.16
R1115:Map1a	UTSW	2	121307378	splice site	probably null
R1166:Map1a	UTSW	2	121300260	missense	probably damaging	1.00
R1326:Map1a	UTSW	2	121306190	nonsense	probably null
R1331:Map1a	UTSW	2	121306220	nonsense	probably null
R1395:Map1a	UTSW	2	121303925	missense	probably benign	0.26
R1489:Map1a	UTSW	2	121300437	missense	possibly damaging	0.91
R1573:Map1a	UTSW	2	121304126	missense	probably benign	0.37
R1596:Map1a	UTSW	2	121289765	missense	probably benign	0.00
R1662:Map1a	UTSW	2	121306408	missense	possibly damaging	0.90
R1919:Map1a	UTSW	2	121307012	missense	probably damaging	1.00
R2122:Map1a	UTSW	2	121299446	missense	probably damaging	1.00
R2126:Map1a	UTSW	2	121298641	missense	probably damaging	0.96
R2143:Map1a	UTSW	2	121301945	missense	probably damaging	1.00
R2172:Map1a	UTSW	2	121307932	missense	probably damaging	1.00
R2249:Map1a	UTSW	2	121300287	missense	probably damaging	1.00
R2254:Map1a	UTSW	2	121303791	missense	possibly damaging	0.71
R2255:Map1a	UTSW	2	121303791	missense	possibly damaging	0.71
R3834:Map1a	UTSW	2	121307322	missense	probably damaging	1.00
R4011:Map1a	UTSW	2	121300127	missense	probably damaging	1.00
R4346:Map1a	UTSW	2	121301325	missense	probably benign	0.13
R4842:Map1a	UTSW	2	121302086	missense	probably damaging	1.00
R4933:Map1a	UTSW	2	121305905	missense	probably damaging	1.00
R4978:Map1a	UTSW	2	121301142	missense	probably benign	0.00
R4988:Map1a	UTSW	2	121303050	missense	probably benign	0.34
R5026:Map1a	UTSW	2	121307538	missense	possibly damaging	0.83
R5086:Map1a	UTSW	2	121304504	missense	probably damaging	1.00
R5155:Map1a	UTSW	2	121302386	missense	probably damaging	1.00
R5232:Map1a	UTSW	2	121301985	missense	probably damaging	1.00
R5311:Map1a	UTSW	2	121302387	missense	probably damaging	1.00
R5401:Map1a	UTSW	2	121299672	missense	probably damaging	1.00
R5465:Map1a	UTSW	2	121306025	missense	probably damaging	1.00
R5526:Map1a	UTSW	2	121305662	missense	probably damaging	1.00
R5642:Map1a	UTSW	2	121306043	missense	probably damaging	1.00
R5726:Map1a	UTSW	2	121305065	missense	probably damaging	1.00
R5817:Map1a	UTSW	2	121298910	missense	possibly damaging	0.81
R5855:Map1a	UTSW	2	121303674	missense	possibly damaging	0.74
R5917:Map1a	UTSW	2	121305216	missense	probably damaging	1.00
R5974:Map1a	UTSW	2	121304376	missense	probably benign	0.20
R5987:Map1a	UTSW	2	121304295	missense	possibly damaging	0.56
R6151:Map1a	UTSW	2	121289823	missense	probably benign	0.12
R6406:Map1a	UTSW	2	121300743	missense	probably damaging	1.00
R7014:Map1a	UTSW	2	121300239	missense	probably damaging	1.00
R7099:Map1a	UTSW	2	121300517	missense	probably benign	0.04
R7211:Map1a	UTSW	2	121304643	missense	probably benign	0.02
R7230:Map1a	UTSW	2	121300818	missense	probably damaging	1.00
R7305:Map1a	UTSW	2	121299458	missense	probably damaging	1.00
R7382:Map1a	UTSW	2	121290785	missense	probably damaging	1.00
R7524:Map1a	UTSW	2	121289812	missense	probably damaging	1.00
R7699:Map1a	UTSW	2	121299720	missense	probably damaging	1.00
R7767:Map1a	UTSW	2	121302036	missense	probably damaging	1.00
R7883:Map1a	UTSW	2	121305372	missense	probably damaging	1.00
R7896:Map1a	UTSW	2	121305176	missense	probably benign	0.00
R7993:Map1a	UTSW	2	121304576	missense	possibly damaging	0.84
R8270:Map1a	UTSW	2	121299020	missense	probably damaging	0.99
R8365:Map1a	UTSW	2	121308047	missense	probably damaging	1.00
R8428:Map1a	UTSW	2	121304937	missense	probably benign	0.42
R8490:Map1a	UTSW	2	121304564	missense	possibly damaging	0.93
R8678:Map1a	UTSW	2	121307256	missense	probably damaging	1.00
R8798:Map1a	UTSW	2	121302287	missense	probably benign	0.20
R8857:Map1a	UTSW	2	121307617	missense	probably damaging	1.00
R8878:Map1a	UTSW	2	121307644	missense	probably damaging	1.00
R8909:Map1a	UTSW	2	121298910	missense	probably damaging	0.99
R8917:Map1a	UTSW	2	121301310	missense	possibly damaging	0.93
R8947:Map1a	UTSW	2	121304969	missense	probably benign	0.27
R9069:Map1a	UTSW	2	121303664	missense	probably benign	0.15
R9198:Map1a	UTSW	2	121303373	missense	probably benign	0.00
R9253:Map1a	UTSW	2	121302342	missense	probably benign	0.00
R9290:Map1a	UTSW	2	121300533	missense	probably damaging	1.00
R9300:Map1a	UTSW	2	121302965	missense	probably damaging	1.00
R9589:Map1a	UTSW	2	121305917	missense	probably damaging	1.00
R9680:Map1a	UTSW	2	121302384	missense	probably damaging	1.00
R9792:Map1a	UTSW	2	121290823	critical splice donor site	probably null
R9793:Map1a	UTSW	2	121290823	critical splice donor site	probably null
R9795:Map1a	UTSW	2	121290823	critical splice donor site	probably null
RF003:Map1a	UTSW	2	121306296	small insertion	probably benign
RF007:Map1a	UTSW	2	121306308	small insertion	probably benign
RF009:Map1a	UTSW	2	121306301	small insertion	probably benign
RF010:Map1a	UTSW	2	121306318	small insertion	probably benign
RF014:Map1a	UTSW	2	121306295	small insertion	probably benign
RF017:Map1a	UTSW	2	121306308	small insertion	probably benign
RF024:Map1a	UTSW	2	121306307	small insertion	probably benign
RF025:Map1a	UTSW	2	121306294	small insertion	probably benign
RF030:Map1a	UTSW	2	121306311	small insertion	probably benign
RF030:Map1a	UTSW	2	121306317	small insertion	probably benign
RF033:Map1a	UTSW	2	121306299	small insertion	probably benign
RF034:Map1a	UTSW	2	121306304	small insertion	probably benign
RF034:Map1a	UTSW	2	121306307	small insertion	probably benign
RF035:Map1a	UTSW	2	121306301	small insertion	probably benign
RF037:Map1a	UTSW	2	121306294	small insertion	probably benign
RF039:Map1a	UTSW	2	121306304	small insertion	probably benign
RF042:Map1a	UTSW	2	121306287	small insertion	probably benign
RF044:Map1a	UTSW	2	121306293	small insertion	probably benign
RF045:Map1a	UTSW	2	121306293	small insertion	probably benign
RF051:Map1a	UTSW	2	121306296	small insertion	probably benign
RF052:Map1a	UTSW	2	121306295	small insertion	probably benign
RF053:Map1a	UTSW	2	121306290	small insertion	probably benign
RF060:Map1a	UTSW	2	121306318	small insertion	probably benign
RF061:Map1a	UTSW	2	121306287	small insertion	probably benign
Z1176:Map1a	UTSW	2	121303238	missense	possibly damaging	0.95
Z1177:Map1a	UTSW	2	121305279	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AAGACAAGGGCTTCAAGTCACCG -3'
(R):5'- ACAGACAGGGACTCTGCATCTTCAG -3'

Sequencing Primer
(F):5'- CGTCTGAGAAACTGTCCAGTC -3'
(R):5'- TCTGCATCTTCAGGGGAAAAGC -3'

Posted On

2014-05-09