Incidental Mutation 'R1675:Sema4a'
ID187983
Institutional Source Beutler Lab
Gene Symbol Sema4a
Ensembl Gene ENSMUSG00000028064
Gene Namesema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A
SynonymsSemB, Semab, SemB
MMRRC Submission 039711-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.916) question?
Stock #R1675 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location88435959-88461182 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 88454766 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 18 (F18I)
Ref Sequence ENSEMBL: ENSMUSP00000114330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029700] [ENSMUST00000107531] [ENSMUST00000123753] [ENSMUST00000125526] [ENSMUST00000127436] [ENSMUST00000141471] [ENSMUST00000147200] [ENSMUST00000165898] [ENSMUST00000166237] [ENSMUST00000169222] [ENSMUST00000184487] [ENSMUST00000184876] [ENSMUST00000185137]
Predicted Effect probably benign
Transcript: ENSMUST00000029700
AA Change: F18I

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000029700
Gene: ENSMUSG00000028064
AA Change: F18I

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Sema 64 478 1.96e-166 SMART
PSI 496 547 9.33e-13 SMART
transmembrane domain 680 702 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107531
SMART Domains Protein: ENSMUSP00000103155
Gene: ENSMUSG00000028064

DomainStartEndE-ValueType
Sema 2 346 2.06e-101 SMART
PSI 364 415 9.33e-13 SMART
transmembrane domain 548 570 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000123753
Predicted Effect probably benign
Transcript: ENSMUST00000125526
AA Change: F18I

PolyPhen 2 Score 0.338 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000119028
Gene: ENSMUSG00000028064
AA Change: F18I

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Sema 64 113 8.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127436
AA Change: F18I

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000118706
Gene: ENSMUSG00000028064
AA Change: F18I

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Sema 64 234 5.5e-53 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135732
Predicted Effect possibly damaging
Transcript: ENSMUST00000141471
AA Change: F18I

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000114330
Gene: ENSMUSG00000028064
AA Change: F18I

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146921
Predicted Effect probably benign
Transcript: ENSMUST00000147200
AA Change: F18I

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000123061
Gene: ENSMUSG00000028064
AA Change: F18I

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Sema 64 203 3.5e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149145
Predicted Effect probably benign
Transcript: ENSMUST00000165898
AA Change: F18I

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000128510
Gene: ENSMUSG00000028064
AA Change: F18I

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Sema 64 478 1.96e-166 SMART
PSI 496 547 9.33e-13 SMART
transmembrane domain 680 702 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166237
AA Change: F18I

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000125909
Gene: ENSMUSG00000028064
AA Change: F18I

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Sema 64 478 1.96e-166 SMART
PSI 496 547 9.33e-13 SMART
transmembrane domain 680 702 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169222
AA Change: F18I

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000128887
Gene: ENSMUSG00000028064
AA Change: F18I

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Sema 64 478 1.96e-166 SMART
PSI 496 547 9.33e-13 SMART
transmembrane domain 680 702 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184487
AA Change: F18I

PolyPhen 2 Score 0.338 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000139126
Gene: ENSMUSG00000028064
AA Change: F18I

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Sema 64 168 1.5e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184876
AA Change: F18I

PolyPhen 2 Score 0.338 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000139159
Gene: ENSMUSG00000028064
AA Change: F18I

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Sema 64 179 7.7e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184972
Predicted Effect probably benign
Transcript: ENSMUST00000185137
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the semaphorin family of soluble and transmembrane proteins. Semaphorins are involved in numerous functions, including axon guidance, morphogenesis, carcinogenesis, and immunomodulation. The encoded protein is a single-pass type I membrane protein containing an immunoglobulin-like C2-type domain, a PSI domain and a sema domain. It inhibits axonal extension by providing local signals to specify territories inaccessible for growing axons. It is an activator of T-cell-mediated immunity and suppresses vascular endothelial growth factor (VEGF)-mediated endothelial cell migration and proliferation in vitro and angiogenesis in vivo. Mutations in this gene are associated with retinal degenerative diseases including retinitis pigmentosa type 35 (RP35) and cone-rod dystrophy type 10 (CORD10). Multiple alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygotes for a knock-out allele show no obvious brain defects but exhibit impaired T cell priming and defective Th1 responses. Homozygotes for a gene trap allele show severe retinal degeneration with reduced retinal vessels, depigmentation and dysfunction of both rod and cone photoreceptors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,263,411 probably null Het
Adam6b T C 12: 113,491,044 Y494H probably benign Het
Adamtsl2 GC G 2: 27,082,485 probably null Het
Anapc2 G A 2: 25,272,639 V42M possibly damaging Het
Aph1a T A 3: 95,894,899 D64E possibly damaging Het
Arhgef11 C T 3: 87,731,211 A1111V possibly damaging Het
Atoh1 T C 6: 64,730,157 S279P probably benign Het
Atp10b A G 11: 43,225,648 T941A probably damaging Het
Barhl1 C T 2: 28,915,411 R90Q possibly damaging Het
Calr3 T C 8: 72,431,458 D91G probably damaging Het
Ccdc148 T C 2: 58,980,554 D317G probably damaging Het
Cnn3 C T 3: 121,457,169 Q19* probably null Het
Cul5 T C 9: 53,646,683 D207G probably benign Het
Cyp4x1 T C 4: 115,127,560 E41G possibly damaging Het
Dagla T A 19: 10,269,323 M138L probably benign Het
Dnah6 A T 6: 73,129,540 M1738K probably damaging Het
Eif4enif1 T A 11: 3,215,686 S88T probably benign Het
Eno3 T C 11: 70,658,666 probably null Het
Erbb3 C A 10: 128,571,204 S1029I probably damaging Het
Erbin C A 13: 103,841,178 V624L probably damaging Het
Fam170b C T 14: 32,835,402 Q65* probably null Het
Fam208b T C 13: 3,569,507 I2241M possibly damaging Het
Gin1 T A 1: 97,786,055 L360* probably null Het
Gldc A T 19: 30,143,453 D359E probably damaging Het
Gpr107 A T 2: 31,167,051 T52S possibly damaging Het
Hip1r A G 5: 123,994,820 Y227C probably damaging Het
Hmgxb3 A G 18: 61,135,559 L1004P probably damaging Het
Hspa1l A G 17: 34,977,443 N153D probably damaging Het
Itga8 C A 2: 12,200,163 V488L probably damaging Het
Kcnk10 G A 12: 98,496,288 A134V probably benign Het
Kif18a T A 2: 109,298,403 C406S probably benign Het
Klhl28 A T 12: 64,951,819 S300R probably damaging Het
Kmt2e C T 5: 23,482,453 Q434* probably null Het
Lilrb4a A G 10: 51,496,185 T222A probably benign Het
Lipn G A 19: 34,080,710 R277Q probably damaging Het
Lrrc61 G A 6: 48,568,774 R177Q possibly damaging Het
Lrrc74a G A 12: 86,741,026 E144K probably damaging Het
Mal T C 2: 127,635,044 Y77C probably benign Het
Map1a T A 2: 121,302,655 C1079* probably null Het
Mbd5 T A 2: 49,256,218 S147T possibly damaging Het
Nsd2 T A 5: 33,861,149 M509K probably benign Het
Olfr1342 C T 4: 118,689,948 R168H probably benign Het
Olfr262 C T 19: 12,240,831 V277I probably benign Het
Olfr414 T C 1: 174,431,097 V223A probably benign Het
Olfr51 T C 11: 51,007,637 F222L probably benign Het
Rcor2 C T 19: 7,270,181 L45F probably damaging Het
Rpl12 T A 2: 32,963,525 D107E probably benign Het
Rpl7l1 A T 17: 46,778,191 F205I probably damaging Het
Samd4b C T 7: 28,414,010 G177R probably damaging Het
Slc37a1 A T 17: 31,338,074 T405S probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Syt14 T C 1: 192,897,482 D781G probably damaging Het
Tprn T G 2: 25,264,409 D574E probably benign Het
Trim75 T A 8: 64,982,511 E429V probably damaging Het
Trit1 C T 4: 123,054,236 R450C possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Unc13c A G 9: 73,639,050 probably null Het
Usp49 C A 17: 47,673,410 L447I probably damaging Het
Vmn1r20 T C 6: 57,431,952 C88R probably benign Het
Zfp94 T A 7: 24,302,834 K394N probably damaging Het
Other mutations in Sema4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Sema4a APN 3 88449810 missense probably damaging 1.00
IGL01722:Sema4a APN 3 88438184 missense probably benign 0.14
IGL01769:Sema4a APN 3 88449756 missense possibly damaging 0.86
IGL02076:Sema4a APN 3 88450522 missense probably damaging 0.99
IGL02202:Sema4a APN 3 88449743 missense probably damaging 1.00
R0145:Sema4a UTSW 3 88451422 missense probably damaging 1.00
R0386:Sema4a UTSW 3 88436800 missense possibly damaging 0.75
R0837:Sema4a UTSW 3 88453098 missense possibly damaging 0.46
R0863:Sema4a UTSW 3 88448149 unclassified probably benign
R1567:Sema4a UTSW 3 88452046 missense probably damaging 1.00
R1739:Sema4a UTSW 3 88436838 missense possibly damaging 0.94
R1801:Sema4a UTSW 3 88436749 missense probably benign 0.04
R1961:Sema4a UTSW 3 88438176 splice site probably benign
R2029:Sema4a UTSW 3 88451361 missense probably damaging 1.00
R4934:Sema4a UTSW 3 88438261 missense probably damaging 1.00
R5006:Sema4a UTSW 3 88436784 missense probably benign
R5309:Sema4a UTSW 3 88437036 missense probably damaging 1.00
R5312:Sema4a UTSW 3 88437036 missense probably damaging 1.00
R5338:Sema4a UTSW 3 88451497 missense probably benign 0.01
R5481:Sema4a UTSW 3 88453040 nonsense probably null
R5510:Sema4a UTSW 3 88449986 critical splice donor site probably null
R6046:Sema4a UTSW 3 88440701 missense probably damaging 1.00
R7242:Sema4a UTSW 3 88450109 missense probably damaging 1.00
Z1176:Sema4a UTSW 3 88437193 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CCACTGAGTTGGCAGAAAAGGGTC -3'
(R):5'- TGAGTAGCGGGCATAAGGTGTCAC -3'

Sequencing Primer
(F):5'- TACAGATCAACTTGTGCCTCAG -3'
(R):5'- CTAGAAGACCTTTGCCCAGG -3'
Posted On2014-05-09