Incidental Mutation 'R1675:Aph1a'
ID187984
Institutional Source Beutler Lab
Gene Symbol Aph1a
Ensembl Gene ENSMUSG00000015750
Gene Nameaph1 homolog A, gamma secretase subunit
Synonyms6530402N02Rik
MMRRC Submission 039711-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1675 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location95893969-95898288 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 95894899 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 64 (D64E)
Ref Sequence ENSEMBL: ENSMUSP00000058846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015894] [ENSMUST00000036181] [ENSMUST00000036360] [ENSMUST00000056710] [ENSMUST00000090476] [ENSMUST00000147962] [ENSMUST00000171519] [ENSMUST00000197081]
Predicted Effect possibly damaging
Transcript: ENSMUST00000015894
AA Change: D64E

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000015894
Gene: ENSMUSG00000015750
AA Change: D64E

DomainStartEndE-ValueType
Pfam:Aph-1 2 246 7.3e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000036181
SMART Domains Protein: ENSMUSP00000036983
Gene: ENSMUSG00000038526

DomainStartEndE-ValueType
Carb_anhydrase 22 278 2.43e-123 SMART
transmembrane domain 290 312 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000036360
SMART Domains Protein: ENSMUSP00000046810
Gene: ENSMUSG00000038543

DomainStartEndE-ValueType
Pfam:DUF4634 1 145 3.6e-64 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000056710
AA Change: D64E

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000058846
Gene: ENSMUSG00000015750
AA Change: D64E

DomainStartEndE-ValueType
Pfam:Aph-1 2 239 1.2e-96 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090476
SMART Domains Protein: ENSMUSP00000102749
Gene: ENSMUSG00000038543

DomainStartEndE-ValueType
Pfam:DUF4634 1 146 1.8e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133611
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145949
Predicted Effect probably benign
Transcript: ENSMUST00000147962
SMART Domains Protein: ENSMUSP00000117464
Gene: ENSMUSG00000038526

DomainStartEndE-ValueType
Carb_anhydrase 8 171 1.79e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171519
SMART Domains Protein: ENSMUSP00000127666
Gene: ENSMUSG00000038543

DomainStartEndE-ValueType
Pfam:DUF4634 1 146 1.5e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197081
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197232
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a subunit of the gamma-secretase complex, which is localized to the endoplasmic reticulum and golgi apparatus. Gamma-secretase is a multi-protein enzyme that catalyzes intramembraneous proteolysis of type I transmembrane proteins and is essential for many signaling pathways, including the Notch signaling pathway. Studies suggest that the protein encoded by this locus binds directly to substrates of the gamma-secretase complex, including the beta-amyloid precursor protein which is associated with Alzheimer disease progression. This gene is required for normal embryonic development and survival, and disruption is associated with defects in the yolk sack angiogenesis, neural tube formation, and somitogenesis. A pseudogene of this gene is located on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous null embryos die by E11, are severely growth retarded by E9.5 and display defects in somite patterning, branchial arch and heart chamber development, vascular morphogenesis of the yolk sac and have distended pericardial sacs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,263,411 probably null Het
Adam6b T C 12: 113,491,044 Y494H probably benign Het
Adamtsl2 GC G 2: 27,082,485 probably null Het
Anapc2 G A 2: 25,272,639 V42M possibly damaging Het
Arhgef11 C T 3: 87,731,211 A1111V possibly damaging Het
Atoh1 T C 6: 64,730,157 S279P probably benign Het
Atp10b A G 11: 43,225,648 T941A probably damaging Het
Barhl1 C T 2: 28,915,411 R90Q possibly damaging Het
Calr3 T C 8: 72,431,458 D91G probably damaging Het
Ccdc148 T C 2: 58,980,554 D317G probably damaging Het
Cnn3 C T 3: 121,457,169 Q19* probably null Het
Cul5 T C 9: 53,646,683 D207G probably benign Het
Cyp4x1 T C 4: 115,127,560 E41G possibly damaging Het
Dagla T A 19: 10,269,323 M138L probably benign Het
Dnah6 A T 6: 73,129,540 M1738K probably damaging Het
Eif4enif1 T A 11: 3,215,686 S88T probably benign Het
Eno3 T C 11: 70,658,666 probably null Het
Erbb3 C A 10: 128,571,204 S1029I probably damaging Het
Erbin C A 13: 103,841,178 V624L probably damaging Het
Fam170b C T 14: 32,835,402 Q65* probably null Het
Fam208b T C 13: 3,569,507 I2241M possibly damaging Het
Gin1 T A 1: 97,786,055 L360* probably null Het
Gldc A T 19: 30,143,453 D359E probably damaging Het
Gpr107 A T 2: 31,167,051 T52S possibly damaging Het
Hip1r A G 5: 123,994,820 Y227C probably damaging Het
Hmgxb3 A G 18: 61,135,559 L1004P probably damaging Het
Hspa1l A G 17: 34,977,443 N153D probably damaging Het
Itga8 C A 2: 12,200,163 V488L probably damaging Het
Kcnk10 G A 12: 98,496,288 A134V probably benign Het
Kif18a T A 2: 109,298,403 C406S probably benign Het
Klhl28 A T 12: 64,951,819 S300R probably damaging Het
Kmt2e C T 5: 23,482,453 Q434* probably null Het
Lilrb4a A G 10: 51,496,185 T222A probably benign Het
Lipn G A 19: 34,080,710 R277Q probably damaging Het
Lrrc61 G A 6: 48,568,774 R177Q possibly damaging Het
Lrrc74a G A 12: 86,741,026 E144K probably damaging Het
Mal T C 2: 127,635,044 Y77C probably benign Het
Map1a T A 2: 121,302,655 C1079* probably null Het
Mbd5 T A 2: 49,256,218 S147T possibly damaging Het
Nsd2 T A 5: 33,861,149 M509K probably benign Het
Olfr1342 C T 4: 118,689,948 R168H probably benign Het
Olfr262 C T 19: 12,240,831 V277I probably benign Het
Olfr414 T C 1: 174,431,097 V223A probably benign Het
Olfr51 T C 11: 51,007,637 F222L probably benign Het
Rcor2 C T 19: 7,270,181 L45F probably damaging Het
Rpl12 T A 2: 32,963,525 D107E probably benign Het
Rpl7l1 A T 17: 46,778,191 F205I probably damaging Het
Samd4b C T 7: 28,414,010 G177R probably damaging Het
Sema4a A T 3: 88,454,766 F18I possibly damaging Het
Slc37a1 A T 17: 31,338,074 T405S probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Syt14 T C 1: 192,897,482 D781G probably damaging Het
Tprn T G 2: 25,264,409 D574E probably benign Het
Trim75 T A 8: 64,982,511 E429V probably damaging Het
Trit1 C T 4: 123,054,236 R450C possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Unc13c A G 9: 73,639,050 probably null Het
Usp49 C A 17: 47,673,410 L447I probably damaging Het
Vmn1r20 T C 6: 57,431,952 C88R probably benign Het
Zfp94 T A 7: 24,302,834 K394N probably damaging Het
Other mutations in Aph1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02103:Aph1a APN 3 95895813 missense probably damaging 0.99
R1735:Aph1a UTSW 3 95895509 missense probably damaging 1.00
R1872:Aph1a UTSW 3 95895564 missense probably damaging 1.00
R2356:Aph1a UTSW 3 95894232 missense probably benign 0.24
R3942:Aph1a UTSW 3 95894261 missense probably damaging 1.00
R4654:Aph1a UTSW 3 95895776 missense probably benign 0.01
R4989:Aph1a UTSW 3 95895531 missense probably damaging 1.00
R5134:Aph1a UTSW 3 95895531 missense probably damaging 1.00
R5184:Aph1a UTSW 3 95895739 unclassified probably null
R6603:Aph1a UTSW 3 95895496 missense probably damaging 1.00
R6650:Aph1a UTSW 3 95896286 missense probably benign 0.28
R8157:Aph1a UTSW 3 95894838 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- TGGTGGAGACACTTATCTGGTCCC -3'
(R):5'- TCCTCACTCAGTGATGCTAAGCCC -3'

Sequencing Primer
(F):5'- GACACTTATCTGGTCCCTGTCTC -3'
(R):5'- AGTGATGCTAAGCCCTCATCTG -3'
Posted On2014-05-09