Incidental Mutation 'R1675:Olfr1342'
ID187987
Institutional Source Beutler Lab
Gene Symbol Olfr1342
Ensembl Gene ENSMUSG00000043383
Gene Nameolfactory receptor 1342
SynonymsGA_x6K02T2QD9B-18856980-18857927, MOR258-3
MMRRC Submission 039711-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R1675 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location118687486-118692756 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 118689948 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 168 (R168H)
Ref Sequence ENSEMBL: ENSMUSP00000149966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060562] [ENSMUST00000216226]
Predicted Effect probably benign
Transcript: ENSMUST00000060562
AA Change: R168H

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000053925
Gene: ENSMUSG00000043383
AA Change: R168H

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
Pfam:7tm_4 34 311 1.5e-55 PFAM
Pfam:7TM_GPCR_Srsx 38 243 1.6e-5 PFAM
Pfam:7tm_1 44 293 4.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216226
AA Change: R168H

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,263,411 probably null Het
Adam6b T C 12: 113,491,044 Y494H probably benign Het
Adamtsl2 GC G 2: 27,082,485 probably null Het
Anapc2 G A 2: 25,272,639 V42M possibly damaging Het
Aph1a T A 3: 95,894,899 D64E possibly damaging Het
Arhgef11 C T 3: 87,731,211 A1111V possibly damaging Het
Atoh1 T C 6: 64,730,157 S279P probably benign Het
Atp10b A G 11: 43,225,648 T941A probably damaging Het
Barhl1 C T 2: 28,915,411 R90Q possibly damaging Het
Calr3 T C 8: 72,431,458 D91G probably damaging Het
Ccdc148 T C 2: 58,980,554 D317G probably damaging Het
Cnn3 C T 3: 121,457,169 Q19* probably null Het
Cul5 T C 9: 53,646,683 D207G probably benign Het
Cyp4x1 T C 4: 115,127,560 E41G possibly damaging Het
Dagla T A 19: 10,269,323 M138L probably benign Het
Dnah6 A T 6: 73,129,540 M1738K probably damaging Het
Eif4enif1 T A 11: 3,215,686 S88T probably benign Het
Eno3 T C 11: 70,658,666 probably null Het
Erbb3 C A 10: 128,571,204 S1029I probably damaging Het
Erbin C A 13: 103,841,178 V624L probably damaging Het
Fam170b C T 14: 32,835,402 Q65* probably null Het
Fam208b T C 13: 3,569,507 I2241M possibly damaging Het
Gin1 T A 1: 97,786,055 L360* probably null Het
Gldc A T 19: 30,143,453 D359E probably damaging Het
Gpr107 A T 2: 31,167,051 T52S possibly damaging Het
Hip1r A G 5: 123,994,820 Y227C probably damaging Het
Hmgxb3 A G 18: 61,135,559 L1004P probably damaging Het
Hspa1l A G 17: 34,977,443 N153D probably damaging Het
Itga8 C A 2: 12,200,163 V488L probably damaging Het
Kcnk10 G A 12: 98,496,288 A134V probably benign Het
Kif18a T A 2: 109,298,403 C406S probably benign Het
Klhl28 A T 12: 64,951,819 S300R probably damaging Het
Kmt2e C T 5: 23,482,453 Q434* probably null Het
Lilrb4a A G 10: 51,496,185 T222A probably benign Het
Lipn G A 19: 34,080,710 R277Q probably damaging Het
Lrrc61 G A 6: 48,568,774 R177Q possibly damaging Het
Lrrc74a G A 12: 86,741,026 E144K probably damaging Het
Mal T C 2: 127,635,044 Y77C probably benign Het
Map1a T A 2: 121,302,655 C1079* probably null Het
Mbd5 T A 2: 49,256,218 S147T possibly damaging Het
Nsd2 T A 5: 33,861,149 M509K probably benign Het
Olfr262 C T 19: 12,240,831 V277I probably benign Het
Olfr414 T C 1: 174,431,097 V223A probably benign Het
Olfr51 T C 11: 51,007,637 F222L probably benign Het
Rcor2 C T 19: 7,270,181 L45F probably damaging Het
Rpl12 T A 2: 32,963,525 D107E probably benign Het
Rpl7l1 A T 17: 46,778,191 F205I probably damaging Het
Samd4b C T 7: 28,414,010 G177R probably damaging Het
Sema4a A T 3: 88,454,766 F18I possibly damaging Het
Slc37a1 A T 17: 31,338,074 T405S probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Syt14 T C 1: 192,897,482 D781G probably damaging Het
Tprn T G 2: 25,264,409 D574E probably benign Het
Trim75 T A 8: 64,982,511 E429V probably damaging Het
Trit1 C T 4: 123,054,236 R450C possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Unc13c A G 9: 73,639,050 probably null Het
Usp49 C A 17: 47,673,410 L447I probably damaging Het
Vmn1r20 T C 6: 57,431,952 C88R probably benign Het
Zfp94 T A 7: 24,302,834 K394N probably damaging Het
Other mutations in Olfr1342
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01823:Olfr1342 APN 4 118689721 missense probably damaging 1.00
IGL02391:Olfr1342 APN 4 118690341 missense probably damaging 1.00
R0648:Olfr1342 UTSW 4 118690072 missense probably benign
R1565:Olfr1342 UTSW 4 118690192 missense probably damaging 1.00
R1823:Olfr1342 UTSW 4 118690192 missense probably damaging 1.00
R2343:Olfr1342 UTSW 4 118690187 missense probably benign 0.30
R4618:Olfr1342 UTSW 4 118689470 utr 3 prime probably benign
R4941:Olfr1342 UTSW 4 118689892 missense possibly damaging 0.76
R5408:Olfr1342 UTSW 4 118690444 missense probably benign 0.00
R5587:Olfr1342 UTSW 4 118689870 missense probably damaging 1.00
R5895:Olfr1342 UTSW 4 118690117 missense probably damaging 0.97
R6023:Olfr1342 UTSW 4 118690074 missense probably damaging 1.00
R6307:Olfr1342 UTSW 4 118689948 missense probably benign 0.00
R6324:Olfr1342 UTSW 4 118690531 start gained probably benign
R6890:Olfr1342 UTSW 4 118689531 missense possibly damaging 0.72
R7218:Olfr1342 UTSW 4 118690018 missense probably benign
R7408:Olfr1342 UTSW 4 118689662 missense probably damaging 0.98
R7555:Olfr1342 UTSW 4 118689642 missense possibly damaging 0.94
R7749:Olfr1342 UTSW 4 118690228 missense probably damaging 1.00
R8098:Olfr1342 UTSW 4 118690209 missense possibly damaging 0.88
Z1176:Olfr1342 UTSW 4 118690272 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- AGAACAGAGCCAGCTTCTTGTCCC -3'
(R):5'- CTCTATGCCATCATGGCCTACGAC -3'

Sequencing Primer
(F):5'- TTCTGGGTCATACCAAGAACCG -3'
(R):5'- TACGACAGGTATGTCGCCATC -3'
Posted On2014-05-09