Incidental Mutation 'R1675:Kmt2e'
ID187991
Institutional Source Beutler Lab
Gene Symbol Kmt2e
Ensembl Gene ENSMUSG00000029004
Gene Namelysine (K)-specific methyltransferase 2E
SynonymsD230038D11Rik, 9530077A04Rik, 1810033J14Rik, Mll5
MMRRC Submission 039711-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1675 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location23434441-23504235 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 23482453 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 434 (Q434*)
Ref Sequence ENSEMBL: ENSMUSP00000110781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094962] [ENSMUST00000115128] [ENSMUST00000146375] [ENSMUST00000196260] [ENSMUST00000196889]
Predicted Effect probably null
Transcript: ENSMUST00000094962
AA Change: Q434*
SMART Domains Protein: ENSMUSP00000092569
Gene: ENSMUSG00000029004
AA Change: Q434*

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
low complexity region 100 109 N/A INTRINSIC
PHD 120 164 4.25e-8 SMART
SET 328 453 2.13e-26 SMART
low complexity region 487 503 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 854 867 N/A INTRINSIC
low complexity region 882 908 N/A INTRINSIC
low complexity region 933 945 N/A INTRINSIC
low complexity region 951 960 N/A INTRINSIC
low complexity region 1184 1197 N/A INTRINSIC
low complexity region 1214 1237 N/A INTRINSIC
low complexity region 1294 1312 N/A INTRINSIC
low complexity region 1348 1367 N/A INTRINSIC
internal_repeat_1 1434 1496 6.13e-7 PROSPERO
low complexity region 1506 1518 N/A INTRINSIC
low complexity region 1625 1641 N/A INTRINSIC
low complexity region 1677 1705 N/A INTRINSIC
low complexity region 1720 1731 N/A INTRINSIC
internal_repeat_1 1783 1842 6.13e-7 PROSPERO
Predicted Effect probably null
Transcript: ENSMUST00000115128
AA Change: Q434*
SMART Domains Protein: ENSMUSP00000110781
Gene: ENSMUSG00000029004
AA Change: Q434*

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
low complexity region 100 109 N/A INTRINSIC
PHD 120 164 4.25e-8 SMART
SET 328 453 2.13e-26 SMART
low complexity region 487 503 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 854 867 N/A INTRINSIC
low complexity region 882 908 N/A INTRINSIC
low complexity region 933 945 N/A INTRINSIC
low complexity region 951 960 N/A INTRINSIC
low complexity region 1184 1197 N/A INTRINSIC
low complexity region 1214 1237 N/A INTRINSIC
low complexity region 1294 1312 N/A INTRINSIC
low complexity region 1348 1367 N/A INTRINSIC
internal_repeat_1 1434 1496 6.13e-7 PROSPERO
low complexity region 1506 1518 N/A INTRINSIC
low complexity region 1625 1641 N/A INTRINSIC
low complexity region 1677 1705 N/A INTRINSIC
low complexity region 1720 1731 N/A INTRINSIC
internal_repeat_1 1783 1842 6.13e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000146375
SMART Domains Protein: ENSMUSP00000142547
Gene: ENSMUSG00000029004

DomainStartEndE-ValueType
low complexity region 104 117 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157545
Predicted Effect probably benign
Transcript: ENSMUST00000196260
SMART Domains Protein: ENSMUSP00000143791
Gene: ENSMUSG00000029004

DomainStartEndE-ValueType
low complexity region 49 62 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196889
SMART Domains Protein: ENSMUSP00000142568
Gene: ENSMUSG00000029004

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
low complexity region 100 109 N/A INTRINSIC
PHD 120 164 2.7e-10 SMART
Blast:SET 216 327 6e-61 BLAST
Blast:SET 328 377 3e-26 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200330
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myeloid/lymphoid or mixed-lineage leukemia (MLL) family and encodes a protein with an N-terminal PHD zinc finger and a central SET domain. Overexpression of the protein inhibits cell cycle progression. Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal and postnatal lethality, reduced fertility and growth, and abnormal lymphopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,263,411 probably null Het
Adam6b T C 12: 113,491,044 Y494H probably benign Het
Adamtsl2 GC G 2: 27,082,485 probably null Het
Anapc2 G A 2: 25,272,639 V42M possibly damaging Het
Aph1a T A 3: 95,894,899 D64E possibly damaging Het
Arhgef11 C T 3: 87,731,211 A1111V possibly damaging Het
Atoh1 T C 6: 64,730,157 S279P probably benign Het
Atp10b A G 11: 43,225,648 T941A probably damaging Het
Barhl1 C T 2: 28,915,411 R90Q possibly damaging Het
Calr3 T C 8: 72,431,458 D91G probably damaging Het
Ccdc148 T C 2: 58,980,554 D317G probably damaging Het
Cnn3 C T 3: 121,457,169 Q19* probably null Het
Cul5 T C 9: 53,646,683 D207G probably benign Het
Cyp4x1 T C 4: 115,127,560 E41G possibly damaging Het
Dagla T A 19: 10,269,323 M138L probably benign Het
Dnah6 A T 6: 73,129,540 M1738K probably damaging Het
Eif4enif1 T A 11: 3,215,686 S88T probably benign Het
Eno3 T C 11: 70,658,666 probably null Het
Erbb3 C A 10: 128,571,204 S1029I probably damaging Het
Erbin C A 13: 103,841,178 V624L probably damaging Het
Fam170b C T 14: 32,835,402 Q65* probably null Het
Fam208b T C 13: 3,569,507 I2241M possibly damaging Het
Gin1 T A 1: 97,786,055 L360* probably null Het
Gldc A T 19: 30,143,453 D359E probably damaging Het
Gpr107 A T 2: 31,167,051 T52S possibly damaging Het
Hip1r A G 5: 123,994,820 Y227C probably damaging Het
Hmgxb3 A G 18: 61,135,559 L1004P probably damaging Het
Hspa1l A G 17: 34,977,443 N153D probably damaging Het
Itga8 C A 2: 12,200,163 V488L probably damaging Het
Kcnk10 G A 12: 98,496,288 A134V probably benign Het
Kif18a T A 2: 109,298,403 C406S probably benign Het
Klhl28 A T 12: 64,951,819 S300R probably damaging Het
Lilrb4a A G 10: 51,496,185 T222A probably benign Het
Lipn G A 19: 34,080,710 R277Q probably damaging Het
Lrrc61 G A 6: 48,568,774 R177Q possibly damaging Het
Lrrc74a G A 12: 86,741,026 E144K probably damaging Het
Mal T C 2: 127,635,044 Y77C probably benign Het
Map1a T A 2: 121,302,655 C1079* probably null Het
Mbd5 T A 2: 49,256,218 S147T possibly damaging Het
Nsd2 T A 5: 33,861,149 M509K probably benign Het
Olfr1342 C T 4: 118,689,948 R168H probably benign Het
Olfr262 C T 19: 12,240,831 V277I probably benign Het
Olfr414 T C 1: 174,431,097 V223A probably benign Het
Olfr51 T C 11: 51,007,637 F222L probably benign Het
Rcor2 C T 19: 7,270,181 L45F probably damaging Het
Rpl12 T A 2: 32,963,525 D107E probably benign Het
Rpl7l1 A T 17: 46,778,191 F205I probably damaging Het
Samd4b C T 7: 28,414,010 G177R probably damaging Het
Sema4a A T 3: 88,454,766 F18I possibly damaging Het
Slc37a1 A T 17: 31,338,074 T405S probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Syt14 T C 1: 192,897,482 D781G probably damaging Het
Tprn T G 2: 25,264,409 D574E probably benign Het
Trim75 T A 8: 64,982,511 E429V probably damaging Het
Trit1 C T 4: 123,054,236 R450C possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Unc13c A G 9: 73,639,050 probably null Het
Usp49 C A 17: 47,673,410 L447I probably damaging Het
Vmn1r20 T C 6: 57,431,952 C88R probably benign Het
Zfp94 T A 7: 24,302,834 K394N probably damaging Het
Other mutations in Kmt2e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Kmt2e APN 5 23492358 missense probably damaging 0.99
IGL01330:Kmt2e APN 5 23497948 missense possibly damaging 0.95
IGL01457:Kmt2e APN 5 23502019 missense possibly damaging 0.62
IGL01691:Kmt2e APN 5 23497091 missense probably benign
IGL02274:Kmt2e APN 5 23500760 missense probably benign 0.00
IGL02934:Kmt2e APN 5 23497884 missense probably damaging 0.97
IGL02964:Kmt2e APN 5 23467100 splice site probably benign
IGL03011:Kmt2e APN 5 23497542 missense probably damaging 1.00
IGL03291:Kmt2e APN 5 23499291 missense probably damaging 1.00
R0035:Kmt2e UTSW 5 23485621 splice site probably benign
R0446:Kmt2e UTSW 5 23497534 splice site probably null
R0498:Kmt2e UTSW 5 23478972 nonsense probably null
R0699:Kmt2e UTSW 5 23473583 missense probably benign 0.01
R0701:Kmt2e UTSW 5 23473583 missense probably benign 0.01
R0761:Kmt2e UTSW 5 23503034 nonsense probably null
R1110:Kmt2e UTSW 5 23502655 missense probably damaging 1.00
R1295:Kmt2e UTSW 5 23502404 missense probably damaging 0.99
R1432:Kmt2e UTSW 5 23450321 missense probably benign 0.39
R1495:Kmt2e UTSW 5 23499327 missense possibly damaging 0.83
R1505:Kmt2e UTSW 5 23500535 missense probably null 0.01
R1623:Kmt2e UTSW 5 23482502 missense probably damaging 1.00
R1691:Kmt2e UTSW 5 23464849 missense probably damaging 1.00
R1778:Kmt2e UTSW 5 23492364 missense probably damaging 1.00
R1820:Kmt2e UTSW 5 23473547 missense probably damaging 1.00
R1846:Kmt2e UTSW 5 23499486 intron probably benign
R1912:Kmt2e UTSW 5 23492395 missense probably benign 0.07
R2070:Kmt2e UTSW 5 23501995 missense probably benign
R2195:Kmt2e UTSW 5 23502196 unclassified probably null
R2571:Kmt2e UTSW 5 23501887 missense probably benign 0.08
R3901:Kmt2e UTSW 5 23501642 missense probably benign 0.02
R3902:Kmt2e UTSW 5 23501642 missense probably benign 0.02
R3905:Kmt2e UTSW 5 23501626 missense probably benign 0.01
R3906:Kmt2e UTSW 5 23501626 missense probably benign 0.01
R3909:Kmt2e UTSW 5 23501626 missense probably benign 0.01
R3956:Kmt2e UTSW 5 23496025 missense probably benign 0.00
R4242:Kmt2e UTSW 5 23502822 unclassified probably benign
R4299:Kmt2e UTSW 5 23464914 missense probably damaging 1.00
R4448:Kmt2e UTSW 5 23464790 missense possibly damaging 0.80
R4528:Kmt2e UTSW 5 23473558 missense possibly damaging 0.69
R4574:Kmt2e UTSW 5 23492407 missense possibly damaging 0.60
R4719:Kmt2e UTSW 5 23492315 missense probably damaging 1.00
R4754:Kmt2e UTSW 5 23482441 missense possibly damaging 0.88
R4787:Kmt2e UTSW 5 23463083 missense possibly damaging 0.65
R4812:Kmt2e UTSW 5 23502587 missense possibly damaging 0.86
R4853:Kmt2e UTSW 5 23502341 missense probably damaging 1.00
R5138:Kmt2e UTSW 5 23502695 missense probably damaging 0.99
R5306:Kmt2e UTSW 5 23499333 missense probably damaging 0.98
R5659:Kmt2e UTSW 5 23497807 missense probably damaging 0.99
R5907:Kmt2e UTSW 5 23464706 missense probably damaging 1.00
R5920:Kmt2e UTSW 5 23499442 missense possibly damaging 0.50
R6280:Kmt2e UTSW 5 23499516 missense possibly damaging 0.48
R6353:Kmt2e UTSW 5 23493245 missense probably damaging 1.00
R6375:Kmt2e UTSW 5 23499519 missense probably benign
R6553:Kmt2e UTSW 5 23463026 missense probably damaging 0.99
R6572:Kmt2e UTSW 5 23497581 missense possibly damaging 0.66
R6678:Kmt2e UTSW 5 23499295 missense possibly damaging 0.54
R6791:Kmt2e UTSW 5 23499476 intron probably benign
R6792:Kmt2e UTSW 5 23499476 intron probably benign
R6794:Kmt2e UTSW 5 23499476 intron probably benign
R6797:Kmt2e UTSW 5 23482507 missense possibly damaging 0.82
R6947:Kmt2e UTSW 5 23497545 missense probably damaging 1.00
R7023:Kmt2e UTSW 5 23500487 missense possibly damaging 0.46
R7036:Kmt2e UTSW 5 23478743 missense probably null 1.00
R7173:Kmt2e UTSW 5 23464857 missense probably damaging 1.00
R7202:Kmt2e UTSW 5 23492294 unclassified probably benign
R7563:Kmt2e UTSW 5 23500273 missense probably damaging 1.00
R7571:Kmt2e UTSW 5 23478587 missense probably damaging 1.00
R7604:Kmt2e UTSW 5 23501765 missense not run
R7722:Kmt2e UTSW 5 23497018 missense probably benign 0.00
R7758:Kmt2e UTSW 5 23496070 missense possibly damaging 0.92
R7794:Kmt2e UTSW 5 23464716 missense probably damaging 1.00
R8137:Kmt2e UTSW 5 23501954 missense probably damaging 1.00
RF026:Kmt2e UTSW 5 23478509 critical splice acceptor site probably benign
RF028:Kmt2e UTSW 5 23478509 critical splice acceptor site probably benign
RF040:Kmt2e UTSW 5 23478509 critical splice acceptor site probably benign
RF042:Kmt2e UTSW 5 23478509 critical splice acceptor site probably benign
Z1177:Kmt2e UTSW 5 23481208 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TTGGCAGTGTACCTCTGAAAACCTTC -3'
(R):5'- GACATAGCGGGTTGCTTAACAAGTTG -3'

Sequencing Primer
(F):5'- cagaaggcagaggcagg -3'
(R):5'- GGTGAAAACCTTGTAACAGCAC -3'
Posted On2014-05-09