Incidental Mutation 'R1675:Nsd2'
ID187992
Institutional Source Beutler Lab
Gene Symbol Nsd2
Ensembl Gene ENSMUSG00000057406
Gene Namenuclear receptor binding SET domain protein 2
Synonyms5830445G22Rik, Whsc1, Whsc1l, C130020C13Rik, 9430010A17Rik, D030027O06Rik, D930023B08Rik
MMRRC Submission 039711-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.805) question?
Stock #R1675 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location33820725-33897975 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33861149 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 509 (M509K)
Ref Sequence ENSEMBL: ENSMUSP00000075210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058096] [ENSMUST00000066854] [ENSMUST00000075812] [ENSMUST00000114397] [ENSMUST00000114399] [ENSMUST00000137191] [ENSMUST00000139845]
Predicted Effect probably benign
Transcript: ENSMUST00000058096
AA Change: M509K

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000058940
Gene: ENSMUSG00000057406
AA Change: M509K

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
PWWP 220 285 3.84e-15 SMART
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
low complexity region 629 643 N/A INTRINSIC
PHD 669 711 1.36e-6 SMART
RING 670 710 1.5e1 SMART
PHD 716 763 6.81e-1 SMART
RING 717 762 5.25e-2 SMART
PHD 833 873 2.35e-10 SMART
PWWP 878 940 2.67e-23 SMART
AWS 1011 1062 3.74e-27 SMART
SET 1063 1186 4.48e-43 SMART
PostSET 1187 1203 7.56e-4 SMART
low complexity region 1215 1236 N/A INTRINSIC
PHD 1241 1284 1.98e-8 SMART
low complexity region 1347 1360 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000066854
AA Change: M509K

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000067205
Gene: ENSMUSG00000057406
AA Change: M509K

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
PWWP 220 285 3.84e-15 SMART
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
low complexity region 630 644 N/A INTRINSIC
PHD 670 712 1.36e-6 SMART
RING 671 711 1.5e1 SMART
PHD 717 764 6.81e-1 SMART
RING 718 763 5.25e-2 SMART
PHD 834 874 2.35e-10 SMART
PWWP 879 941 2.67e-23 SMART
AWS 1012 1063 3.74e-27 SMART
SET 1064 1187 4.48e-43 SMART
PostSET 1188 1204 7.56e-4 SMART
low complexity region 1216 1237 N/A INTRINSIC
PHD 1242 1285 1.98e-8 SMART
low complexity region 1348 1361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075812
AA Change: M509K

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000075210
Gene: ENSMUSG00000057406
AA Change: M509K

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
PWWP 220 285 3.84e-15 SMART
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
low complexity region 630 644 N/A INTRINSIC
PHD 670 712 1.36e-6 SMART
RING 671 711 1.5e1 SMART
PHD 717 764 6.81e-1 SMART
RING 718 763 5.25e-2 SMART
PHD 834 874 2.35e-10 SMART
PWWP 879 941 2.67e-23 SMART
AWS 1012 1063 3.74e-27 SMART
SET 1064 1187 4.48e-43 SMART
PostSET 1188 1204 7.56e-4 SMART
low complexity region 1216 1237 N/A INTRINSIC
PHD 1242 1285 1.98e-8 SMART
low complexity region 1348 1361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114397
AA Change: M509K

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000110039
Gene: ENSMUSG00000057406
AA Change: M509K

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Pfam:PWWP 220 332 4.7e-26 PFAM
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114399
AA Change: M509K

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000110041
Gene: ENSMUSG00000057406
AA Change: M509K

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Pfam:PWWP 220 332 4.9e-26 PFAM
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137191
AA Change: M509K

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000122310
Gene: ENSMUSG00000057406
AA Change: M509K

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Pfam:PWWP 220 332 4.9e-26 PFAM
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139845
AA Change: M509K

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000123460
Gene: ENSMUSG00000057406
AA Change: M509K

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Pfam:PWWP 220 332 4.9e-26 PFAM
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000141416
AA Change: M490K
SMART Domains Protein: ENSMUSP00000117233
Gene: ENSMUSG00000057406
AA Change: M490K

DomainStartEndE-ValueType
Pfam:PWWP 202 314 1.1e-25 PFAM
low complexity region 379 390 N/A INTRINSIC
HMG 434 504 4.7e-9 SMART
Predicted Effect unknown
Transcript: ENSMUST00000142080
AA Change: M27K
SMART Domains Protein: ENSMUSP00000115251
Gene: ENSMUSG00000057406
AA Change: M27K

DomainStartEndE-ValueType
Blast:SET 2 148 7e-47 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains four domains present in other developmental proteins: a PWWP domain, an HMG box, a SET domain, and a PHD-type zinc finger. It is expressed ubiquitously in early development. Wolf-Hirschhorn syndrome (WHS) is a malformation syndrome associated with a hemizygous deletion of the distal short arm of chromosome 4. This gene maps to the 165 kb WHS critical region and has also been involved in the chromosomal translocation t(4;14)(p16.3;q32.3) in multiple myelomas. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. Some transcript variants are nonsense-mediated mRNA (NMD) decay candidates, hence not represented as reference sequences. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display reduced fetal size, failed sternum ossification, cleft palate, atrial and ventricular septal defects, stunted growth and postnatal death. Some heterozygotes show severe growth defects, malocclusion, delayed sternum ossification and hypoplasia of the septum secundum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,263,411 probably null Het
Adam6b T C 12: 113,491,044 Y494H probably benign Het
Adamtsl2 GC G 2: 27,082,485 probably null Het
Anapc2 G A 2: 25,272,639 V42M possibly damaging Het
Aph1a T A 3: 95,894,899 D64E possibly damaging Het
Arhgef11 C T 3: 87,731,211 A1111V possibly damaging Het
Atoh1 T C 6: 64,730,157 S279P probably benign Het
Atp10b A G 11: 43,225,648 T941A probably damaging Het
Barhl1 C T 2: 28,915,411 R90Q possibly damaging Het
Calr3 T C 8: 72,431,458 D91G probably damaging Het
Ccdc148 T C 2: 58,980,554 D317G probably damaging Het
Cnn3 C T 3: 121,457,169 Q19* probably null Het
Cul5 T C 9: 53,646,683 D207G probably benign Het
Cyp4x1 T C 4: 115,127,560 E41G possibly damaging Het
Dagla T A 19: 10,269,323 M138L probably benign Het
Dnah6 A T 6: 73,129,540 M1738K probably damaging Het
Eif4enif1 T A 11: 3,215,686 S88T probably benign Het
Eno3 T C 11: 70,658,666 probably null Het
Erbb3 C A 10: 128,571,204 S1029I probably damaging Het
Erbin C A 13: 103,841,178 V624L probably damaging Het
Fam170b C T 14: 32,835,402 Q65* probably null Het
Fam208b T C 13: 3,569,507 I2241M possibly damaging Het
Gin1 T A 1: 97,786,055 L360* probably null Het
Gldc A T 19: 30,143,453 D359E probably damaging Het
Gpr107 A T 2: 31,167,051 T52S possibly damaging Het
Hip1r A G 5: 123,994,820 Y227C probably damaging Het
Hmgxb3 A G 18: 61,135,559 L1004P probably damaging Het
Hspa1l A G 17: 34,977,443 N153D probably damaging Het
Itga8 C A 2: 12,200,163 V488L probably damaging Het
Kcnk10 G A 12: 98,496,288 A134V probably benign Het
Kif18a T A 2: 109,298,403 C406S probably benign Het
Klhl28 A T 12: 64,951,819 S300R probably damaging Het
Kmt2e C T 5: 23,482,453 Q434* probably null Het
Lilrb4a A G 10: 51,496,185 T222A probably benign Het
Lipn G A 19: 34,080,710 R277Q probably damaging Het
Lrrc61 G A 6: 48,568,774 R177Q possibly damaging Het
Lrrc74a G A 12: 86,741,026 E144K probably damaging Het
Mal T C 2: 127,635,044 Y77C probably benign Het
Map1a T A 2: 121,302,655 C1079* probably null Het
Mbd5 T A 2: 49,256,218 S147T possibly damaging Het
Olfr1342 C T 4: 118,689,948 R168H probably benign Het
Olfr262 C T 19: 12,240,831 V277I probably benign Het
Olfr414 T C 1: 174,431,097 V223A probably benign Het
Olfr51 T C 11: 51,007,637 F222L probably benign Het
Rcor2 C T 19: 7,270,181 L45F probably damaging Het
Rpl12 T A 2: 32,963,525 D107E probably benign Het
Rpl7l1 A T 17: 46,778,191 F205I probably damaging Het
Samd4b C T 7: 28,414,010 G177R probably damaging Het
Sema4a A T 3: 88,454,766 F18I possibly damaging Het
Slc37a1 A T 17: 31,338,074 T405S probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Syt14 T C 1: 192,897,482 D781G probably damaging Het
Tprn T G 2: 25,264,409 D574E probably benign Het
Trim75 T A 8: 64,982,511 E429V probably damaging Het
Trit1 C T 4: 123,054,236 R450C possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Unc13c A G 9: 73,639,050 probably null Het
Usp49 C A 17: 47,673,410 L447I probably damaging Het
Vmn1r20 T C 6: 57,431,952 C88R probably benign Het
Zfp94 T A 7: 24,302,834 K394N probably damaging Het
Other mutations in Nsd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Nsd2 APN 5 33855733 missense probably damaging 1.00
IGL00420:Nsd2 APN 5 33883003 missense possibly damaging 0.82
IGL01343:Nsd2 APN 5 33843578 missense probably damaging 1.00
IGL01403:Nsd2 APN 5 33885378 splice site probably benign
IGL01446:Nsd2 APN 5 33861186 splice site probably benign
IGL01571:Nsd2 APN 5 33864687 missense probably benign 0.32
IGL01862:Nsd2 APN 5 33843736 missense probably null 1.00
IGL02040:Nsd2 APN 5 33867571 splice site probably benign
IGL02528:Nsd2 APN 5 33879051 unclassified probably benign
IGL02553:Nsd2 APN 5 33846198 missense probably damaging 1.00
IGL02799:Nsd2 APN 5 33864788 splice site probably benign
IGL02932:Nsd2 APN 5 33880128 missense probably damaging 1.00
Tennis UTSW 5 33843513 missense probably damaging 1.00
R0136:Nsd2 UTSW 5 33855536 missense possibly damaging 0.89
R0372:Nsd2 UTSW 5 33891551 missense probably damaging 0.98
R0521:Nsd2 UTSW 5 33843338 missense probably damaging 1.00
R0548:Nsd2 UTSW 5 33893538 missense probably damaging 1.00
R0726:Nsd2 UTSW 5 33861028 unclassified probably benign
R1018:Nsd2 UTSW 5 33843241 missense probably damaging 1.00
R1638:Nsd2 UTSW 5 33882120 missense possibly damaging 0.87
R1649:Nsd2 UTSW 5 33854640 missense probably damaging 0.98
R1900:Nsd2 UTSW 5 33846169 missense probably benign
R2001:Nsd2 UTSW 5 33843402 missense probably damaging 1.00
R2167:Nsd2 UTSW 5 33882919 missense probably damaging 1.00
R2261:Nsd2 UTSW 5 33885527 missense probably damaging 1.00
R2966:Nsd2 UTSW 5 33846122 missense probably benign 0.01
R3931:Nsd2 UTSW 5 33846117 missense probably benign 0.01
R4429:Nsd2 UTSW 5 33843202 missense probably damaging 1.00
R4596:Nsd2 UTSW 5 33882918 missense probably damaging 1.00
R4958:Nsd2 UTSW 5 33892022 missense probably damaging 1.00
R5346:Nsd2 UTSW 5 33879136 missense possibly damaging 0.94
R5957:Nsd2 UTSW 5 33855603 missense probably damaging 1.00
R6054:Nsd2 UTSW 5 33882161 missense probably damaging 1.00
R6124:Nsd2 UTSW 5 33843266 missense probably benign 0.08
R6302:Nsd2 UTSW 5 33867577 missense possibly damaging 0.93
R6390:Nsd2 UTSW 5 33881181 missense probably damaging 1.00
R6496:Nsd2 UTSW 5 33843513 missense probably damaging 1.00
R6828:Nsd2 UTSW 5 33893568 missense probably damaging 0.98
R6925:Nsd2 UTSW 5 33879110 missense probably damaging 1.00
R7148:Nsd2 UTSW 5 33885511 missense possibly damaging 0.57
R7311:Nsd2 UTSW 5 33892036 missense probably damaging 1.00
R7337:Nsd2 UTSW 5 33885472 missense probably damaging 1.00
R7466:Nsd2 UTSW 5 33882147 nonsense probably null
R7567:Nsd2 UTSW 5 33846226 missense probably damaging 0.99
R7704:Nsd2 UTSW 5 33871467 makesense probably null
R7822:Nsd2 UTSW 5 33843594 missense probably damaging 0.97
X0020:Nsd2 UTSW 5 33854757 missense probably damaging 1.00
Z1088:Nsd2 UTSW 5 33855738 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTTCGTTAAGCCAGATTTTCTGGGACA -3'
(R):5'- CCAAAACACACCTGCATGGGTGAT -3'

Sequencing Primer
(F):5'- TAGCTGAACATCCAGATGCC -3'
(R):5'- CACCTGCATGGGTGATAAGGG -3'
Posted On2014-05-09