Incidental Mutation 'R1675:Hip1r'
ID187994
Institutional Source Beutler Lab
Gene Symbol Hip1r
Ensembl Gene ENSMUSG00000000915
Gene Namehuntingtin interacting protein 1 related
Synonyms
MMRRC Submission 039711-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1675 (G1)
Quality Score185
Status Not validated
Chromosome5
Chromosomal Location123973628-124005558 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123994820 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 227 (Y227C)
Ref Sequence ENSEMBL: ENSMUSP00000000939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000939] [ENSMUST00000167879]
Predicted Effect probably damaging
Transcript: ENSMUST00000000939
AA Change: Y227C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000000939
Gene: ENSMUSG00000000915
AA Change: Y227C

DomainStartEndE-ValueType
ENTH 29 151 5.27e-40 SMART
low complexity region 301 321 N/A INTRINSIC
PDB:3I00|B 340 458 1e-21 PDB
Pfam:HIP1_clath_bdg 461 559 1.1e-34 PFAM
low complexity region 627 633 N/A INTRINSIC
ILWEQ 814 1012 9.19e-121 SMART
low complexity region 1016 1035 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000166258
AA Change: Y5C
SMART Domains Protein: ENSMUSP00000130766
Gene: ENSMUSG00000000915
AA Change: Y5C

DomainStartEndE-ValueType
Pfam:ANTH 1 79 3.5e-19 PFAM
low complexity region 80 100 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167879
SMART Domains Protein: ENSMUSP00000127361
Gene: ENSMUSG00000000915

DomainStartEndE-ValueType
Pfam:ANTH 29 117 1.3e-29 PFAM
Pfam:ENTH 30 117 6.1e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171407
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185154
Predicted Effect probably benign
Transcript: ENSMUST00000198664
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,263,411 probably null Het
Adam6b T C 12: 113,491,044 Y494H probably benign Het
Adamtsl2 GC G 2: 27,082,485 probably null Het
Anapc2 G A 2: 25,272,639 V42M possibly damaging Het
Aph1a T A 3: 95,894,899 D64E possibly damaging Het
Arhgef11 C T 3: 87,731,211 A1111V possibly damaging Het
Atoh1 T C 6: 64,730,157 S279P probably benign Het
Atp10b A G 11: 43,225,648 T941A probably damaging Het
Barhl1 C T 2: 28,915,411 R90Q possibly damaging Het
Calr3 T C 8: 72,431,458 D91G probably damaging Het
Ccdc148 T C 2: 58,980,554 D317G probably damaging Het
Cnn3 C T 3: 121,457,169 Q19* probably null Het
Cul5 T C 9: 53,646,683 D207G probably benign Het
Cyp4x1 T C 4: 115,127,560 E41G possibly damaging Het
Dagla T A 19: 10,269,323 M138L probably benign Het
Dnah6 A T 6: 73,129,540 M1738K probably damaging Het
Eif4enif1 T A 11: 3,215,686 S88T probably benign Het
Eno3 T C 11: 70,658,666 probably null Het
Erbb3 C A 10: 128,571,204 S1029I probably damaging Het
Erbin C A 13: 103,841,178 V624L probably damaging Het
Fam170b C T 14: 32,835,402 Q65* probably null Het
Fam208b T C 13: 3,569,507 I2241M possibly damaging Het
Gin1 T A 1: 97,786,055 L360* probably null Het
Gldc A T 19: 30,143,453 D359E probably damaging Het
Gpr107 A T 2: 31,167,051 T52S possibly damaging Het
Hmgxb3 A G 18: 61,135,559 L1004P probably damaging Het
Hspa1l A G 17: 34,977,443 N153D probably damaging Het
Itga8 C A 2: 12,200,163 V488L probably damaging Het
Kcnk10 G A 12: 98,496,288 A134V probably benign Het
Kif18a T A 2: 109,298,403 C406S probably benign Het
Klhl28 A T 12: 64,951,819 S300R probably damaging Het
Kmt2e C T 5: 23,482,453 Q434* probably null Het
Lilrb4a A G 10: 51,496,185 T222A probably benign Het
Lipn G A 19: 34,080,710 R277Q probably damaging Het
Lrrc61 G A 6: 48,568,774 R177Q possibly damaging Het
Lrrc74a G A 12: 86,741,026 E144K probably damaging Het
Mal T C 2: 127,635,044 Y77C probably benign Het
Map1a T A 2: 121,302,655 C1079* probably null Het
Mbd5 T A 2: 49,256,218 S147T possibly damaging Het
Nsd2 T A 5: 33,861,149 M509K probably benign Het
Olfr1342 C T 4: 118,689,948 R168H probably benign Het
Olfr262 C T 19: 12,240,831 V277I probably benign Het
Olfr414 T C 1: 174,431,097 V223A probably benign Het
Olfr51 T C 11: 51,007,637 F222L probably benign Het
Rcor2 C T 19: 7,270,181 L45F probably damaging Het
Rpl12 T A 2: 32,963,525 D107E probably benign Het
Rpl7l1 A T 17: 46,778,191 F205I probably damaging Het
Samd4b C T 7: 28,414,010 G177R probably damaging Het
Sema4a A T 3: 88,454,766 F18I possibly damaging Het
Slc37a1 A T 17: 31,338,074 T405S probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Syt14 T C 1: 192,897,482 D781G probably damaging Het
Tprn T G 2: 25,264,409 D574E probably benign Het
Trim75 T A 8: 64,982,511 E429V probably damaging Het
Trit1 C T 4: 123,054,236 R450C possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Unc13c A G 9: 73,639,050 probably null Het
Usp49 C A 17: 47,673,410 L447I probably damaging Het
Vmn1r20 T C 6: 57,431,952 C88R probably benign Het
Zfp94 T A 7: 24,302,834 K394N probably damaging Het
Other mutations in Hip1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Hip1r APN 5 123989735 critical splice donor site probably null
IGL01771:Hip1r APN 5 123999543 missense possibly damaging 0.95
IGL01804:Hip1r APN 5 124001550 critical splice donor site probably null
IGL02100:Hip1r APN 5 123998943 unclassified probably benign
IGL02139:Hip1r APN 5 123996244 missense probably damaging 1.00
IGL02321:Hip1r APN 5 123999890 missense probably damaging 0.99
IGL02562:Hip1r APN 5 123991523 unclassified probably benign
IGL02745:Hip1r APN 5 123990939 splice site probably null
IGL02798:Hip1r APN 5 123994712 unclassified probably benign
IGL03365:Hip1r APN 5 124000167 missense probably damaging 1.00
R0172:Hip1r UTSW 5 123996940 missense possibly damaging 0.47
R0546:Hip1r UTSW 5 123999051 missense possibly damaging 0.89
R0799:Hip1r UTSW 5 123996941 missense probably benign 0.00
R1588:Hip1r UTSW 5 123996575 missense probably damaging 0.98
R1590:Hip1r UTSW 5 124002140 missense probably benign 0.00
R1801:Hip1r UTSW 5 123998808 missense probably benign
R1818:Hip1r UTSW 5 123995955 critical splice donor site probably null
R1852:Hip1r UTSW 5 123991505 missense probably benign 0.10
R1936:Hip1r UTSW 5 123996071 missense probably damaging 1.00
R1954:Hip1r UTSW 5 124001844 missense probably damaging 0.96
R1989:Hip1r UTSW 5 123989698 missense probably damaging 1.00
R2045:Hip1r UTSW 5 124000731 missense probably benign
R2105:Hip1r UTSW 5 124000204 missense probably damaging 0.96
R2414:Hip1r UTSW 5 124001243 missense probably damaging 1.00
R2909:Hip1r UTSW 5 124000593 splice site probably null
R3125:Hip1r UTSW 5 124000141 missense probably benign 0.20
R3401:Hip1r UTSW 5 123996983 missense probably damaging 1.00
R3402:Hip1r UTSW 5 123996983 missense probably damaging 1.00
R3889:Hip1r UTSW 5 124001791 nonsense probably null
R4212:Hip1r UTSW 5 123999890 missense probably benign 0.06
R4421:Hip1r UTSW 5 123997862 missense possibly damaging 0.66
R4422:Hip1r UTSW 5 123997006 missense possibly damaging 0.93
R4713:Hip1r UTSW 5 123989980 missense probably benign 0.02
R6837:Hip1r UTSW 5 123998865 missense possibly damaging 0.63
R7171:Hip1r UTSW 5 123995944 missense probably benign 0.02
R7212:Hip1r UTSW 5 123973782 missense possibly damaging 0.91
R7251:Hip1r UTSW 5 123994750 missense probably damaging 1.00
R7319:Hip1r UTSW 5 123999111 missense probably damaging 1.00
R7432:Hip1r UTSW 5 123991766 missense probably benign 0.05
R7592:Hip1r UTSW 5 123997973 missense probably benign 0.21
R7708:Hip1r UTSW 5 123997469 missense possibly damaging 0.82
R7773:Hip1r UTSW 5 124001441 missense probably benign 0.00
R8132:Hip1r UTSW 5 123997227 missense probably damaging 1.00
Z1088:Hip1r UTSW 5 123999132 splice site probably null
Z1176:Hip1r UTSW 5 123997010 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGAGCTGCCACTAAAGTGGACC -3'
(R):5'- CAGTCGTCGTCGtcgtctttcttc -3'

Sequencing Primer
(F):5'- TCAGTTTTCCGGCAGCTCA -3'
(R):5'- tcttctcctctctctctctctc -3'
Posted On2014-05-09