Incidental Mutation 'R1675:Lrrc61'
ID187995
Institutional Source Beutler Lab
Gene Symbol Lrrc61
Ensembl Gene ENSMUSG00000073096
Gene Nameleucine rich repeat containing 61
Synonyms
MMRRC Submission 039711-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R1675 (G1)
Quality Score189
Status Not validated
Chromosome6
Chromosomal Location48554796-48570722 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 48568774 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 177 (R177Q)
Ref Sequence ENSEMBL: ENSMUSP00000110192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009425] [ENSMUST00000101436] [ENSMUST00000114545] [ENSMUST00000153222] [ENSMUST00000203627] [ENSMUST00000204071] [ENSMUST00000204182] [ENSMUST00000204267] [ENSMUST00000204930]
Predicted Effect probably benign
Transcript: ENSMUST00000009425
SMART Domains Protein: ENSMUSP00000009425
Gene: ENSMUSG00000009281

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000101436
AA Change: R177Q

PolyPhen 2 Score 0.639 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000098979
Gene: ENSMUSG00000073096
AA Change: R177Q

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:LRR_1 54 75 1.5e-3 PFAM
Pfam:LRR_8 54 109 8.5e-9 PFAM
low complexity region 113 124 N/A INTRINSIC
low complexity region 177 191 N/A INTRINSIC
low complexity region 236 249 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114545
AA Change: R177Q

PolyPhen 2 Score 0.639 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110192
Gene: ENSMUSG00000073096
AA Change: R177Q

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:LRR_8 32 87 3.1e-9 PFAM
Pfam:LRR_6 52 76 1.8e-4 PFAM
Pfam:LRR_4 53 95 1.7e-12 PFAM
Pfam:LRR_1 54 74 8.6e-5 PFAM
Pfam:LRR_8 75 131 7.8e-9 PFAM
low complexity region 177 191 N/A INTRINSIC
low complexity region 236 249 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146245
Predicted Effect probably benign
Transcript: ENSMUST00000153222
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203541
Predicted Effect probably benign
Transcript: ENSMUST00000203627
SMART Domains Protein: ENSMUSP00000145141
Gene: ENSMUSG00000073096

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:LRR_8 30 87 1.2e-6 PFAM
Pfam:LRR_4 53 95 1.1e-6 PFAM
Pfam:LRR_1 54 75 2.1e-1 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204071
Predicted Effect probably benign
Transcript: ENSMUST00000204182
SMART Domains Protein: ENSMUSP00000145257
Gene: ENSMUSG00000009281

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204267
SMART Domains Protein: ENSMUSP00000144793
Gene: ENSMUSG00000009281

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204930
SMART Domains Protein: ENSMUSP00000144799
Gene: ENSMUSG00000009281

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Meta Mutation Damage Score 0.1418 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,263,411 probably null Het
Adam6b T C 12: 113,491,044 Y494H probably benign Het
Adamtsl2 GC G 2: 27,082,485 probably null Het
Anapc2 G A 2: 25,272,639 V42M possibly damaging Het
Aph1a T A 3: 95,894,899 D64E possibly damaging Het
Arhgef11 C T 3: 87,731,211 A1111V possibly damaging Het
Atoh1 T C 6: 64,730,157 S279P probably benign Het
Atp10b A G 11: 43,225,648 T941A probably damaging Het
Barhl1 C T 2: 28,915,411 R90Q possibly damaging Het
Calr3 T C 8: 72,431,458 D91G probably damaging Het
Ccdc148 T C 2: 58,980,554 D317G probably damaging Het
Cnn3 C T 3: 121,457,169 Q19* probably null Het
Cul5 T C 9: 53,646,683 D207G probably benign Het
Cyp4x1 T C 4: 115,127,560 E41G possibly damaging Het
Dagla T A 19: 10,269,323 M138L probably benign Het
Dnah6 A T 6: 73,129,540 M1738K probably damaging Het
Eif4enif1 T A 11: 3,215,686 S88T probably benign Het
Eno3 T C 11: 70,658,666 probably null Het
Erbb3 C A 10: 128,571,204 S1029I probably damaging Het
Erbin C A 13: 103,841,178 V624L probably damaging Het
Fam170b C T 14: 32,835,402 Q65* probably null Het
Fam208b T C 13: 3,569,507 I2241M possibly damaging Het
Gin1 T A 1: 97,786,055 L360* probably null Het
Gldc A T 19: 30,143,453 D359E probably damaging Het
Gpr107 A T 2: 31,167,051 T52S possibly damaging Het
Hip1r A G 5: 123,994,820 Y227C probably damaging Het
Hmgxb3 A G 18: 61,135,559 L1004P probably damaging Het
Hspa1l A G 17: 34,977,443 N153D probably damaging Het
Itga8 C A 2: 12,200,163 V488L probably damaging Het
Kcnk10 G A 12: 98,496,288 A134V probably benign Het
Kif18a T A 2: 109,298,403 C406S probably benign Het
Klhl28 A T 12: 64,951,819 S300R probably damaging Het
Kmt2e C T 5: 23,482,453 Q434* probably null Het
Lilrb4a A G 10: 51,496,185 T222A probably benign Het
Lipn G A 19: 34,080,710 R277Q probably damaging Het
Lrrc74a G A 12: 86,741,026 E144K probably damaging Het
Mal T C 2: 127,635,044 Y77C probably benign Het
Map1a T A 2: 121,302,655 C1079* probably null Het
Mbd5 T A 2: 49,256,218 S147T possibly damaging Het
Nsd2 T A 5: 33,861,149 M509K probably benign Het
Olfr1342 C T 4: 118,689,948 R168H probably benign Het
Olfr262 C T 19: 12,240,831 V277I probably benign Het
Olfr414 T C 1: 174,431,097 V223A probably benign Het
Olfr51 T C 11: 51,007,637 F222L probably benign Het
Rcor2 C T 19: 7,270,181 L45F probably damaging Het
Rpl12 T A 2: 32,963,525 D107E probably benign Het
Rpl7l1 A T 17: 46,778,191 F205I probably damaging Het
Samd4b C T 7: 28,414,010 G177R probably damaging Het
Sema4a A T 3: 88,454,766 F18I possibly damaging Het
Slc37a1 A T 17: 31,338,074 T405S probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Syt14 T C 1: 192,897,482 D781G probably damaging Het
Tprn T G 2: 25,264,409 D574E probably benign Het
Trim75 T A 8: 64,982,511 E429V probably damaging Het
Trit1 C T 4: 123,054,236 R450C possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Unc13c A G 9: 73,639,050 probably null Het
Usp49 C A 17: 47,673,410 L447I probably damaging Het
Vmn1r20 T C 6: 57,431,952 C88R probably benign Het
Zfp94 T A 7: 24,302,834 K394N probably damaging Het
Other mutations in Lrrc61
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1713:Lrrc61 UTSW 6 48568774 missense possibly damaging 0.64
R2352:Lrrc61 UTSW 6 48568872 missense probably benign 0.02
R5337:Lrrc61 UTSW 6 48568374 missense probably damaging 0.96
R5774:Lrrc61 UTSW 6 48568199 unclassified probably benign
R6208:Lrrc61 UTSW 6 48568905 nonsense probably null
R6887:Lrrc61 UTSW 6 48568432 missense probably damaging 1.00
R7835:Lrrc61 UTSW 6 48568572 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCCACTAGCAGCTTGTGAGAACC -3'
(R):5'- CTGACGATCCAGGTCAAGGCATTC -3'

Sequencing Primer
(F):5'- AATGCTGCTGGTAACCTGC -3'
(R):5'- CATTCCTGCAGTGTGTCCT -3'
Posted On2014-05-09