Incidental Mutation 'R1675:Zfp94'
ID187999
Institutional Source Beutler Lab
Gene Symbol Zfp94
Ensembl Gene ENSMUSG00000074282
Gene Namezinc finger protein 94
Synonyms
MMRRC Submission 039711-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R1675 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location24301704-24316666 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24302834 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 394 (K394N)
Ref Sequence ENSEMBL: ENSMUSP00000104075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032673] [ENSMUST00000077780] [ENSMUST00000108436] [ENSMUST00000145131]
Predicted Effect probably damaging
Transcript: ENSMUST00000032673
AA Change: K388N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032673
Gene: ENSMUSG00000074282
AA Change: K388N

DomainStartEndE-ValueType
KRAB 2 59 3.06e-19 SMART
ZnF_C2H2 157 179 5.06e-2 SMART
ZnF_C2H2 185 207 8.47e-4 SMART
ZnF_C2H2 213 235 4.72e-2 SMART
ZnF_C2H2 241 263 1.28e-3 SMART
ZnF_C2H2 269 291 5.21e-4 SMART
ZnF_C2H2 297 319 9.08e-4 SMART
ZnF_C2H2 325 347 2.09e-3 SMART
ZnF_C2H2 353 375 8.94e-3 SMART
ZnF_C2H2 381 403 2.4e-3 SMART
ZnF_C2H2 409 431 8.6e-5 SMART
ZnF_C2H2 437 459 7.9e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077780
SMART Domains Protein: ENSMUSP00000076954
Gene: ENSMUSG00000050605

DomainStartEndE-ValueType
KRAB 4 63 2.28e-27 SMART
ZnF_C2H2 311 333 1.4e-4 SMART
ZnF_C2H2 339 361 5.5e-3 SMART
ZnF_C2H2 367 389 2.99e-4 SMART
ZnF_C2H2 395 417 1.18e-2 SMART
ZnF_C2H2 423 445 2.4e-3 SMART
ZnF_C2H2 451 473 2.95e-3 SMART
ZnF_C2H2 479 501 9.88e-5 SMART
ZnF_C2H2 507 529 1.5e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108436
AA Change: K394N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104075
Gene: ENSMUSG00000074282
AA Change: K394N

DomainStartEndE-ValueType
KRAB 8 65 3.06e-19 SMART
ZnF_C2H2 163 185 5.06e-2 SMART
ZnF_C2H2 191 213 8.47e-4 SMART
ZnF_C2H2 219 241 4.72e-2 SMART
ZnF_C2H2 247 269 1.28e-3 SMART
ZnF_C2H2 275 297 5.21e-4 SMART
ZnF_C2H2 303 325 9.08e-4 SMART
ZnF_C2H2 331 353 2.09e-3 SMART
ZnF_C2H2 359 381 8.94e-3 SMART
ZnF_C2H2 387 409 2.4e-3 SMART
ZnF_C2H2 415 437 8.6e-5 SMART
ZnF_C2H2 443 465 7.9e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128421
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138619
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139811
Predicted Effect probably benign
Transcript: ENSMUST00000145131
SMART Domains Protein: ENSMUSP00000117077
Gene: ENSMUSG00000050605

DomainStartEndE-ValueType
KRAB 4 64 4.63e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146817
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206535
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,263,411 probably null Het
Adam6b T C 12: 113,491,044 Y494H probably benign Het
Adamtsl2 GC G 2: 27,082,485 probably null Het
Anapc2 G A 2: 25,272,639 V42M possibly damaging Het
Aph1a T A 3: 95,894,899 D64E possibly damaging Het
Arhgef11 C T 3: 87,731,211 A1111V possibly damaging Het
Atoh1 T C 6: 64,730,157 S279P probably benign Het
Atp10b A G 11: 43,225,648 T941A probably damaging Het
Barhl1 C T 2: 28,915,411 R90Q possibly damaging Het
Calr3 T C 8: 72,431,458 D91G probably damaging Het
Ccdc148 T C 2: 58,980,554 D317G probably damaging Het
Cnn3 C T 3: 121,457,169 Q19* probably null Het
Cul5 T C 9: 53,646,683 D207G probably benign Het
Cyp4x1 T C 4: 115,127,560 E41G possibly damaging Het
Dagla T A 19: 10,269,323 M138L probably benign Het
Dnah6 A T 6: 73,129,540 M1738K probably damaging Het
Eif4enif1 T A 11: 3,215,686 S88T probably benign Het
Eno3 T C 11: 70,658,666 probably null Het
Erbb3 C A 10: 128,571,204 S1029I probably damaging Het
Erbin C A 13: 103,841,178 V624L probably damaging Het
Fam170b C T 14: 32,835,402 Q65* probably null Het
Fam208b T C 13: 3,569,507 I2241M possibly damaging Het
Gin1 T A 1: 97,786,055 L360* probably null Het
Gldc A T 19: 30,143,453 D359E probably damaging Het
Gpr107 A T 2: 31,167,051 T52S possibly damaging Het
Hip1r A G 5: 123,994,820 Y227C probably damaging Het
Hmgxb3 A G 18: 61,135,559 L1004P probably damaging Het
Hspa1l A G 17: 34,977,443 N153D probably damaging Het
Itga8 C A 2: 12,200,163 V488L probably damaging Het
Kcnk10 G A 12: 98,496,288 A134V probably benign Het
Kif18a T A 2: 109,298,403 C406S probably benign Het
Klhl28 A T 12: 64,951,819 S300R probably damaging Het
Kmt2e C T 5: 23,482,453 Q434* probably null Het
Lilrb4a A G 10: 51,496,185 T222A probably benign Het
Lipn G A 19: 34,080,710 R277Q probably damaging Het
Lrrc61 G A 6: 48,568,774 R177Q possibly damaging Het
Lrrc74a G A 12: 86,741,026 E144K probably damaging Het
Mal T C 2: 127,635,044 Y77C probably benign Het
Map1a T A 2: 121,302,655 C1079* probably null Het
Mbd5 T A 2: 49,256,218 S147T possibly damaging Het
Nsd2 T A 5: 33,861,149 M509K probably benign Het
Olfr1342 C T 4: 118,689,948 R168H probably benign Het
Olfr262 C T 19: 12,240,831 V277I probably benign Het
Olfr414 T C 1: 174,431,097 V223A probably benign Het
Olfr51 T C 11: 51,007,637 F222L probably benign Het
Rcor2 C T 19: 7,270,181 L45F probably damaging Het
Rpl12 T A 2: 32,963,525 D107E probably benign Het
Rpl7l1 A T 17: 46,778,191 F205I probably damaging Het
Samd4b C T 7: 28,414,010 G177R probably damaging Het
Sema4a A T 3: 88,454,766 F18I possibly damaging Het
Slc37a1 A T 17: 31,338,074 T405S probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Syt14 T C 1: 192,897,482 D781G probably damaging Het
Tprn T G 2: 25,264,409 D574E probably benign Het
Trim75 T A 8: 64,982,511 E429V probably damaging Het
Trit1 C T 4: 123,054,236 R450C possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Unc13c A G 9: 73,639,050 probably null Het
Usp49 C A 17: 47,673,410 L447I probably damaging Het
Vmn1r20 T C 6: 57,431,952 C88R probably benign Het
Other mutations in Zfp94
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01755:Zfp94 APN 7 24311481 utr 5 prime probably benign
IGL02645:Zfp94 APN 7 24303754 missense probably benign
R0684:Zfp94 UTSW 7 24303070 missense probably damaging 1.00
R1177:Zfp94 UTSW 7 24303528 missense probably damaging 1.00
R1644:Zfp94 UTSW 7 24311502 splice site probably benign
R1826:Zfp94 UTSW 7 24309115 missense probably damaging 1.00
R1861:Zfp94 UTSW 7 24309116 missense probably damaging 1.00
R3932:Zfp94 UTSW 7 24303687 missense probably benign 0.06
R4912:Zfp94 UTSW 7 24303741 missense probably benign 0.05
R5663:Zfp94 UTSW 7 24302827 missense probably damaging 1.00
R6539:Zfp94 UTSW 7 24303291 missense probably damaging 1.00
R7023:Zfp94 UTSW 7 24303396 missense probably damaging 1.00
R7710:Zfp94 UTSW 7 24303682 missense probably benign
R7810:Zfp94 UTSW 7 24303073 missense probably benign 0.00
R8134:Zfp94 UTSW 7 24303741 missense probably benign 0.40
R8291:Zfp94 UTSW 7 24302730 missense probably damaging 1.00
Z1176:Zfp94 UTSW 7 24303811 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GATGCAGGCAAATCCTTGCGAC -3'
(R):5'- ACAGTGAAGACAAACCGTACCAGTG -3'

Sequencing Primer
(F):5'- tggtgaattaggagacttgagc -3'
(R):5'- CGCAGAGTGTGGGAGGG -3'
Posted On2014-05-09