Incidental Mutation 'R1675:Calr3'
ID188003
Institutional Source Beutler Lab
Gene Symbol Calr3
Ensembl Gene ENSMUSG00000019732
Gene Namecalreticulin 3
SynonymsCrt2, 6330586I20Rik, calsperin, 1700031L01Rik
MMRRC Submission 039711-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R1675 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location72424176-72443870 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72431458 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 91 (D91G)
Ref Sequence ENSEMBL: ENSMUSP00000105601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019876] [ENSMUST00000109974]
Predicted Effect probably damaging
Transcript: ENSMUST00000019876
AA Change: D199G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019876
Gene: ENSMUSG00000019732
AA Change: D199G

DomainStartEndE-ValueType
Pfam:Calreticulin 23 256 5.7e-40 PFAM
Pfam:Calreticulin 255 315 6.6e-7 PFAM
low complexity region 345 359 N/A INTRINSIC
low complexity region 365 376 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109974
AA Change: D91G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105601
Gene: ENSMUSG00000019732
AA Change: D91G

DomainStartEndE-ValueType
Pfam:Calreticulin 23 207 7.9e-32 PFAM
low complexity region 237 251 N/A INTRINSIC
low complexity region 257 268 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120752
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the calreticulin family, members of which are calcium-binding chaperones localized mainly in the endoplasmic reticulum. This protein is also localized to the endoplasmic reticulum lumen, however, its capacity for calcium-binding may be absent or much lower than other family members. This gene is specifically expressed in the testis, and may be required for sperm fertility. Mutation in this gene has been associated with familial hypertrophic cardiomyopathy. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility associated with impaired zona pellucida binding and fertilization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,263,411 probably null Het
Adam6b T C 12: 113,491,044 Y494H probably benign Het
Adamtsl2 GC G 2: 27,082,485 probably null Het
Anapc2 G A 2: 25,272,639 V42M possibly damaging Het
Aph1a T A 3: 95,894,899 D64E possibly damaging Het
Arhgef11 C T 3: 87,731,211 A1111V possibly damaging Het
Atoh1 T C 6: 64,730,157 S279P probably benign Het
Atp10b A G 11: 43,225,648 T941A probably damaging Het
Barhl1 C T 2: 28,915,411 R90Q possibly damaging Het
Ccdc148 T C 2: 58,980,554 D317G probably damaging Het
Cnn3 C T 3: 121,457,169 Q19* probably null Het
Cul5 T C 9: 53,646,683 D207G probably benign Het
Cyp4x1 T C 4: 115,127,560 E41G possibly damaging Het
Dagla T A 19: 10,269,323 M138L probably benign Het
Dnah6 A T 6: 73,129,540 M1738K probably damaging Het
Eif4enif1 T A 11: 3,215,686 S88T probably benign Het
Eno3 T C 11: 70,658,666 probably null Het
Erbb3 C A 10: 128,571,204 S1029I probably damaging Het
Erbin C A 13: 103,841,178 V624L probably damaging Het
Fam170b C T 14: 32,835,402 Q65* probably null Het
Fam208b T C 13: 3,569,507 I2241M possibly damaging Het
Gin1 T A 1: 97,786,055 L360* probably null Het
Gldc A T 19: 30,143,453 D359E probably damaging Het
Gpr107 A T 2: 31,167,051 T52S possibly damaging Het
Hip1r A G 5: 123,994,820 Y227C probably damaging Het
Hmgxb3 A G 18: 61,135,559 L1004P probably damaging Het
Hspa1l A G 17: 34,977,443 N153D probably damaging Het
Itga8 C A 2: 12,200,163 V488L probably damaging Het
Kcnk10 G A 12: 98,496,288 A134V probably benign Het
Kif18a T A 2: 109,298,403 C406S probably benign Het
Klhl28 A T 12: 64,951,819 S300R probably damaging Het
Kmt2e C T 5: 23,482,453 Q434* probably null Het
Lilrb4a A G 10: 51,496,185 T222A probably benign Het
Lipn G A 19: 34,080,710 R277Q probably damaging Het
Lrrc61 G A 6: 48,568,774 R177Q possibly damaging Het
Lrrc74a G A 12: 86,741,026 E144K probably damaging Het
Mal T C 2: 127,635,044 Y77C probably benign Het
Map1a T A 2: 121,302,655 C1079* probably null Het
Mbd5 T A 2: 49,256,218 S147T possibly damaging Het
Nsd2 T A 5: 33,861,149 M509K probably benign Het
Olfr1342 C T 4: 118,689,948 R168H probably benign Het
Olfr262 C T 19: 12,240,831 V277I probably benign Het
Olfr414 T C 1: 174,431,097 V223A probably benign Het
Olfr51 T C 11: 51,007,637 F222L probably benign Het
Rcor2 C T 19: 7,270,181 L45F probably damaging Het
Rpl12 T A 2: 32,963,525 D107E probably benign Het
Rpl7l1 A T 17: 46,778,191 F205I probably damaging Het
Samd4b C T 7: 28,414,010 G177R probably damaging Het
Sema4a A T 3: 88,454,766 F18I possibly damaging Het
Slc37a1 A T 17: 31,338,074 T405S probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Syt14 T C 1: 192,897,482 D781G probably damaging Het
Tprn T G 2: 25,264,409 D574E probably benign Het
Trim75 T A 8: 64,982,511 E429V probably damaging Het
Trit1 C T 4: 123,054,236 R450C possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Unc13c A G 9: 73,639,050 probably null Het
Usp49 C A 17: 47,673,410 L447I probably damaging Het
Vmn1r20 T C 6: 57,431,952 C88R probably benign Het
Zfp94 T A 7: 24,302,834 K394N probably damaging Het
Other mutations in Calr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Calr3 APN 8 72431396 nonsense probably null
IGL01358:Calr3 APN 8 72427213 nonsense probably null
IGL02440:Calr3 APN 8 72431432 missense probably benign 0.30
IGL02646:Calr3 APN 8 72443460 missense possibly damaging 0.89
IGL02882:Calr3 APN 8 72434821 missense probably damaging 0.99
IGL02945:Calr3 APN 8 72438557 missense probably damaging 1.00
IGL03025:Calr3 APN 8 72434891 splice site probably benign
IGL03175:Calr3 APN 8 72443605 missense probably damaging 1.00
R0140:Calr3 UTSW 8 72434888 splice site probably benign
R1518:Calr3 UTSW 8 72427200 missense probably damaging 0.97
R2006:Calr3 UTSW 8 72434851 missense probably damaging 1.00
R2111:Calr3 UTSW 8 72427268 missense probably damaging 0.99
R2202:Calr3 UTSW 8 72434839 missense probably damaging 1.00
R2296:Calr3 UTSW 8 72424625 unclassified probably benign
R2432:Calr3 UTSW 8 72438426 unclassified probably benign
R3946:Calr3 UTSW 8 72443620 missense probably damaging 1.00
R4382:Calr3 UTSW 8 72428164 missense probably damaging 1.00
R4383:Calr3 UTSW 8 72428164 missense probably damaging 1.00
R4384:Calr3 UTSW 8 72428164 missense probably damaging 1.00
R4385:Calr3 UTSW 8 72428164 missense probably damaging 1.00
R4943:Calr3 UTSW 8 72431377 missense probably benign 0.18
R5132:Calr3 UTSW 8 72431368 splice site probably null
R7337:Calr3 UTSW 8 72431495 missense probably damaging 1.00
R7879:Calr3 UTSW 8 72424643 missense unknown
R8132:Calr3 UTSW 8 72427179 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGAAGCTACAGTGCAAGCAGG -3'
(R):5'- AGTCAGGTATAGTGGTACAGTGCTCG -3'

Sequencing Primer
(F):5'- CTGGACTTTACTGCCTTCCA -3'
(R):5'- tgtgccacccccaacag -3'
Posted On2014-05-09