Incidental Mutation 'R1675:Klhl28'
ID 188013
Institutional Source Beutler Lab
Gene Symbol Klhl28
Ensembl Gene ENSMUSG00000020948
Gene Name kelch-like 28
Synonyms Btbd5, 4122402F11Rik, 4931401E10Rik, 2810440N09Rik
MMRRC Submission 039711-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.144) question?
Stock # R1675 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 64985607-65012308 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 64998593 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 300 (S300R)
Ref Sequence ENSEMBL: ENSMUSP00000152602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021331] [ENSMUST00000222508]
AlphaFold Q9CR40
Predicted Effect probably damaging
Transcript: ENSMUST00000021331
AA Change: S300R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021331
Gene: ENSMUSG00000020948
AA Change: S300R

DomainStartEndE-ValueType
BTB 35 132 3.55e-30 SMART
BACK 137 239 1.83e-36 SMART
Kelch 284 331 3.52e-4 SMART
Kelch 332 386 4.23e-7 SMART
Kelch 387 433 1.99e-12 SMART
Kelch 434 479 1.64e-13 SMART
Kelch 480 526 5.12e-15 SMART
Kelch 527 571 5.29e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221957
Predicted Effect probably damaging
Transcript: ENSMUST00000222508
AA Change: S300R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,302,570 (GRCm39) probably null Het
Adam6b T C 12: 113,454,664 (GRCm39) Y494H probably benign Het
Adamtsl2 GC G 2: 26,972,497 (GRCm39) probably null Het
Anapc2 G A 2: 25,162,651 (GRCm39) V42M possibly damaging Het
Aph1a T A 3: 95,802,211 (GRCm39) D64E possibly damaging Het
Arhgef11 C T 3: 87,638,518 (GRCm39) A1111V possibly damaging Het
Atoh1 T C 6: 64,707,141 (GRCm39) S279P probably benign Het
Atp10b A G 11: 43,116,475 (GRCm39) T941A probably damaging Het
Barhl1 C T 2: 28,805,423 (GRCm39) R90Q possibly damaging Het
Calr3 T C 8: 73,185,302 (GRCm39) D91G probably damaging Het
Ccdc148 T C 2: 58,870,566 (GRCm39) D317G probably damaging Het
Cnn3 C T 3: 121,250,818 (GRCm39) Q19* probably null Het
Cul5 T C 9: 53,557,983 (GRCm39) D207G probably benign Het
Cyp4x1 T C 4: 114,984,757 (GRCm39) E41G possibly damaging Het
Dagla T A 19: 10,246,687 (GRCm39) M138L probably benign Het
Dnah6 A T 6: 73,106,523 (GRCm39) M1738K probably damaging Het
Eif4enif1 T A 11: 3,165,686 (GRCm39) S88T probably benign Het
Eno3 T C 11: 70,549,492 (GRCm39) probably null Het
Erbb3 C A 10: 128,407,073 (GRCm39) S1029I probably damaging Het
Erbin C A 13: 103,977,686 (GRCm39) V624L probably damaging Het
Fam170b C T 14: 32,557,359 (GRCm39) Q65* probably null Het
Gin1 T A 1: 97,713,780 (GRCm39) L360* probably null Het
Gldc A T 19: 30,120,853 (GRCm39) D359E probably damaging Het
Gpr107 A T 2: 31,057,063 (GRCm39) T52S possibly damaging Het
Hip1r A G 5: 124,132,883 (GRCm39) Y227C probably damaging Het
Hmgxb3 A G 18: 61,268,631 (GRCm39) L1004P probably damaging Het
Hspa1l A G 17: 35,196,419 (GRCm39) N153D probably damaging Het
Itga8 C A 2: 12,204,974 (GRCm39) V488L probably damaging Het
Kcnk10 G A 12: 98,462,547 (GRCm39) A134V probably benign Het
Kif18a T A 2: 109,128,748 (GRCm39) C406S probably benign Het
Kmt2e C T 5: 23,687,451 (GRCm39) Q434* probably null Het
Lilrb4a A G 10: 51,372,281 (GRCm39) T222A probably benign Het
Lipn G A 19: 34,058,110 (GRCm39) R277Q probably damaging Het
Lrrc61 G A 6: 48,545,708 (GRCm39) R177Q possibly damaging Het
Lrrc74a G A 12: 86,787,800 (GRCm39) E144K probably damaging Het
Mal T C 2: 127,476,964 (GRCm39) Y77C probably benign Het
Map1a T A 2: 121,133,136 (GRCm39) C1079* probably null Het
Mbd5 T A 2: 49,146,230 (GRCm39) S147T possibly damaging Het
Nsd2 T A 5: 34,018,493 (GRCm39) M509K probably benign Het
Or13p4 C T 4: 118,547,145 (GRCm39) R168H probably benign Het
Or1ad8 T C 11: 50,898,464 (GRCm39) F222L probably benign Het
Or5an1c C T 19: 12,218,195 (GRCm39) V277I probably benign Het
Or6p1 T C 1: 174,258,663 (GRCm39) V223A probably benign Het
Rcor2 C T 19: 7,247,546 (GRCm39) L45F probably damaging Het
Rpl12 T A 2: 32,853,537 (GRCm39) D107E probably benign Het
Rpl7l1 A T 17: 47,089,117 (GRCm39) F205I probably damaging Het
Samd4b C T 7: 28,113,435 (GRCm39) G177R probably damaging Het
Sema4a A T 3: 88,362,073 (GRCm39) F18I possibly damaging Het
Slc37a1 A T 17: 31,557,048 (GRCm39) T405S probably damaging Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Syt14 T C 1: 192,579,790 (GRCm39) D781G probably damaging Het
Tasor2 T C 13: 3,619,507 (GRCm39) I2241M possibly damaging Het
Tprn T G 2: 25,154,421 (GRCm39) D574E probably benign Het
Trim75 T A 8: 65,435,163 (GRCm39) E429V probably damaging Het
Trit1 C T 4: 122,948,029 (GRCm39) R450C possibly damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Unc13c A G 9: 73,546,332 (GRCm39) probably null Het
Usp49 C A 17: 47,984,335 (GRCm39) L447I probably damaging Het
Vmn1r20 T C 6: 57,408,937 (GRCm39) C88R probably benign Het
Zfp94 T A 7: 24,002,259 (GRCm39) K394N probably damaging Het
Other mutations in Klhl28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Klhl28 APN 12 64,996,840 (GRCm39) missense probably damaging 1.00
IGL03059:Klhl28 APN 12 64,998,340 (GRCm39) missense probably benign 0.00
IGL03246:Klhl28 APN 12 65,004,060 (GRCm39) missense probably benign
R0014:Klhl28 UTSW 12 65,004,076 (GRCm39) missense probably benign 0.06
R0607:Klhl28 UTSW 12 64,998,529 (GRCm39) missense probably damaging 1.00
R0975:Klhl28 UTSW 12 64,998,462 (GRCm39) missense possibly damaging 0.67
R1134:Klhl28 UTSW 12 64,998,391 (GRCm39) missense probably benign 0.01
R1480:Klhl28 UTSW 12 65,003,995 (GRCm39) missense probably damaging 1.00
R2064:Klhl28 UTSW 12 64,990,246 (GRCm39) missense probably benign 0.05
R3832:Klhl28 UTSW 12 64,998,195 (GRCm39) missense probably damaging 1.00
R3896:Klhl28 UTSW 12 65,004,333 (GRCm39) missense probably damaging 1.00
R4327:Klhl28 UTSW 12 64,996,952 (GRCm39) missense probably damaging 1.00
R4612:Klhl28 UTSW 12 65,004,034 (GRCm39) missense probably damaging 0.99
R4817:Klhl28 UTSW 12 65,004,043 (GRCm39) missense probably benign 0.00
R4872:Klhl28 UTSW 12 65,003,896 (GRCm39) missense possibly damaging 0.94
R5007:Klhl28 UTSW 12 65,004,001 (GRCm39) missense probably damaging 0.98
R5008:Klhl28 UTSW 12 65,004,001 (GRCm39) missense probably damaging 0.98
R5010:Klhl28 UTSW 12 65,004,001 (GRCm39) missense probably damaging 0.98
R5068:Klhl28 UTSW 12 65,004,486 (GRCm39) missense probably benign 0.10
R5070:Klhl28 UTSW 12 65,004,486 (GRCm39) missense probably benign 0.10
R6666:Klhl28 UTSW 12 64,990,301 (GRCm39) missense probably benign 0.11
R7812:Klhl28 UTSW 12 64,990,363 (GRCm39) missense possibly damaging 0.74
R7951:Klhl28 UTSW 12 65,003,875 (GRCm39) missense probably damaging 1.00
R8219:Klhl28 UTSW 12 64,998,431 (GRCm39) missense probably benign 0.45
R8411:Klhl28 UTSW 12 64,996,864 (GRCm39) missense probably damaging 1.00
R8526:Klhl28 UTSW 12 64,998,400 (GRCm39) missense probably damaging 0.96
R9103:Klhl28 UTSW 12 64,990,300 (GRCm39) missense possibly damaging 0.94
R9769:Klhl28 UTSW 12 64,998,330 (GRCm39) missense probably benign 0.00
R9789:Klhl28 UTSW 12 64,996,871 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTGACAGTCATACCAGGACGCACG -3'
(R):5'- TCCAGAGTGAACAAACCCCACATGTA -3'

Sequencing Primer
(F):5'- GGACGCACGCTAGTTTCAATAC -3'
(R):5'- gtttataccagtttacactcttagcc -3'
Posted On 2014-05-09