Incidental Mutation 'R1675:Klhl28'
Institutional Source Beutler Lab
Gene Symbol Klhl28
Ensembl Gene ENSMUSG00000020948
Gene Namekelch-like 28
SynonymsBtbd5, 4122402F11Rik, 2810440N09Rik, 4931401E10Rik
MMRRC Submission 039711-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R1675 (G1)
Quality Score225
Status Not validated
Chromosomal Location64938833-64965534 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 64951819 bp
Amino Acid Change Serine to Arginine at position 300 (S300R)
Ref Sequence ENSEMBL: ENSMUSP00000152602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021331] [ENSMUST00000222508]
Predicted Effect probably damaging
Transcript: ENSMUST00000021331
AA Change: S300R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021331
Gene: ENSMUSG00000020948
AA Change: S300R

BTB 35 132 3.55e-30 SMART
BACK 137 239 1.83e-36 SMART
Kelch 284 331 3.52e-4 SMART
Kelch 332 386 4.23e-7 SMART
Kelch 387 433 1.99e-12 SMART
Kelch 434 479 1.64e-13 SMART
Kelch 480 526 5.12e-15 SMART
Kelch 527 571 5.29e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221957
Predicted Effect probably damaging
Transcript: ENSMUST00000222508
AA Change: S300R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,263,411 probably null Het
Adam6b T C 12: 113,491,044 Y494H probably benign Het
Adamtsl2 GC G 2: 27,082,485 probably null Het
Anapc2 G A 2: 25,272,639 V42M possibly damaging Het
Aph1a T A 3: 95,894,899 D64E possibly damaging Het
Arhgef11 C T 3: 87,731,211 A1111V possibly damaging Het
Atoh1 T C 6: 64,730,157 S279P probably benign Het
Atp10b A G 11: 43,225,648 T941A probably damaging Het
Barhl1 C T 2: 28,915,411 R90Q possibly damaging Het
Calr3 T C 8: 72,431,458 D91G probably damaging Het
Ccdc148 T C 2: 58,980,554 D317G probably damaging Het
Cnn3 C T 3: 121,457,169 Q19* probably null Het
Cul5 T C 9: 53,646,683 D207G probably benign Het
Cyp4x1 T C 4: 115,127,560 E41G possibly damaging Het
Dagla T A 19: 10,269,323 M138L probably benign Het
Dnah6 A T 6: 73,129,540 M1738K probably damaging Het
Eif4enif1 T A 11: 3,215,686 S88T probably benign Het
Eno3 T C 11: 70,658,666 probably null Het
Erbb3 C A 10: 128,571,204 S1029I probably damaging Het
Erbin C A 13: 103,841,178 V624L probably damaging Het
Fam170b C T 14: 32,835,402 Q65* probably null Het
Fam208b T C 13: 3,569,507 I2241M possibly damaging Het
Gin1 T A 1: 97,786,055 L360* probably null Het
Gldc A T 19: 30,143,453 D359E probably damaging Het
Gpr107 A T 2: 31,167,051 T52S possibly damaging Het
Hip1r A G 5: 123,994,820 Y227C probably damaging Het
Hmgxb3 A G 18: 61,135,559 L1004P probably damaging Het
Hspa1l A G 17: 34,977,443 N153D probably damaging Het
Itga8 C A 2: 12,200,163 V488L probably damaging Het
Kcnk10 G A 12: 98,496,288 A134V probably benign Het
Kif18a T A 2: 109,298,403 C406S probably benign Het
Kmt2e C T 5: 23,482,453 Q434* probably null Het
Lilrb4a A G 10: 51,496,185 T222A probably benign Het
Lipn G A 19: 34,080,710 R277Q probably damaging Het
Lrrc61 G A 6: 48,568,774 R177Q possibly damaging Het
Lrrc74a G A 12: 86,741,026 E144K probably damaging Het
Mal T C 2: 127,635,044 Y77C probably benign Het
Map1a T A 2: 121,302,655 C1079* probably null Het
Mbd5 T A 2: 49,256,218 S147T possibly damaging Het
Nsd2 T A 5: 33,861,149 M509K probably benign Het
Olfr1342 C T 4: 118,689,948 R168H probably benign Het
Olfr262 C T 19: 12,240,831 V277I probably benign Het
Olfr414 T C 1: 174,431,097 V223A probably benign Het
Olfr51 T C 11: 51,007,637 F222L probably benign Het
Rcor2 C T 19: 7,270,181 L45F probably damaging Het
Rpl12 T A 2: 32,963,525 D107E probably benign Het
Rpl7l1 A T 17: 46,778,191 F205I probably damaging Het
Samd4b C T 7: 28,414,010 G177R probably damaging Het
Sema4a A T 3: 88,454,766 F18I possibly damaging Het
Slc37a1 A T 17: 31,338,074 T405S probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Syt14 T C 1: 192,897,482 D781G probably damaging Het
Tprn T G 2: 25,264,409 D574E probably benign Het
Trim75 T A 8: 64,982,511 E429V probably damaging Het
Trit1 C T 4: 123,054,236 R450C possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Unc13c A G 9: 73,639,050 probably null Het
Usp49 C A 17: 47,673,410 L447I probably damaging Het
Vmn1r20 T C 6: 57,431,952 C88R probably benign Het
Zfp94 T A 7: 24,302,834 K394N probably damaging Het
Other mutations in Klhl28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Klhl28 APN 12 64950066 missense probably damaging 1.00
IGL03059:Klhl28 APN 12 64951566 missense probably benign 0.00
IGL03246:Klhl28 APN 12 64957286 missense probably benign
R0014:Klhl28 UTSW 12 64957302 missense probably benign 0.06
R0607:Klhl28 UTSW 12 64951755 missense probably damaging 1.00
R0975:Klhl28 UTSW 12 64951688 missense possibly damaging 0.67
R1134:Klhl28 UTSW 12 64951617 missense probably benign 0.01
R1480:Klhl28 UTSW 12 64957221 missense probably damaging 1.00
R2064:Klhl28 UTSW 12 64943472 missense probably benign 0.05
R3832:Klhl28 UTSW 12 64951421 missense probably damaging 1.00
R3896:Klhl28 UTSW 12 64957559 missense probably damaging 1.00
R4327:Klhl28 UTSW 12 64950178 missense probably damaging 1.00
R4612:Klhl28 UTSW 12 64957260 missense probably damaging 0.99
R4817:Klhl28 UTSW 12 64957269 missense probably benign 0.00
R4872:Klhl28 UTSW 12 64957122 missense possibly damaging 0.94
R5007:Klhl28 UTSW 12 64957227 missense probably damaging 0.98
R5008:Klhl28 UTSW 12 64957227 missense probably damaging 0.98
R5010:Klhl28 UTSW 12 64957227 missense probably damaging 0.98
R5068:Klhl28 UTSW 12 64957712 missense probably benign 0.10
R5070:Klhl28 UTSW 12 64957712 missense probably benign 0.10
R6666:Klhl28 UTSW 12 64943527 missense probably benign 0.11
R7812:Klhl28 UTSW 12 64943589 missense possibly damaging 0.74
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gtttataccagtttacactcttagcc -3'
Posted On2014-05-09