Incidental Mutation 'R1675:Adam6b'
ID188017
Institutional Source Beutler Lab
Gene Symbol Adam6b
Ensembl Gene ENSMUSG00000051804
Gene Namea disintegrin and metallopeptidase domain 6B
Synonyms4930523C11Rik
MMRRC Submission 039711-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R1675 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location113489511-113492057 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113491044 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 494 (Y494H)
Ref Sequence ENSEMBL: ENSMUSP00000065529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063317]
Predicted Effect probably benign
Transcript: ENSMUST00000063317
AA Change: Y494H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000065529
Gene: ENSMUSG00000051804
AA Change: Y494H

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 30 167 1.1e-16 PFAM
Pfam:Reprolysin 223 407 1.1e-14 PFAM
DISIN 427 502 9.2e-33 SMART
ACR 503 640 2.74e-60 SMART
transmembrane domain 704 726 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,263,411 probably null Het
Adamtsl2 GC G 2: 27,082,485 probably null Het
Anapc2 G A 2: 25,272,639 V42M possibly damaging Het
Aph1a T A 3: 95,894,899 D64E possibly damaging Het
Arhgef11 C T 3: 87,731,211 A1111V possibly damaging Het
Atoh1 T C 6: 64,730,157 S279P probably benign Het
Atp10b A G 11: 43,225,648 T941A probably damaging Het
Barhl1 C T 2: 28,915,411 R90Q possibly damaging Het
Calr3 T C 8: 72,431,458 D91G probably damaging Het
Ccdc148 T C 2: 58,980,554 D317G probably damaging Het
Cnn3 C T 3: 121,457,169 Q19* probably null Het
Cul5 T C 9: 53,646,683 D207G probably benign Het
Cyp4x1 T C 4: 115,127,560 E41G possibly damaging Het
Dagla T A 19: 10,269,323 M138L probably benign Het
Dnah6 A T 6: 73,129,540 M1738K probably damaging Het
Eif4enif1 T A 11: 3,215,686 S88T probably benign Het
Eno3 T C 11: 70,658,666 probably null Het
Erbb3 C A 10: 128,571,204 S1029I probably damaging Het
Erbin C A 13: 103,841,178 V624L probably damaging Het
Fam170b C T 14: 32,835,402 Q65* probably null Het
Fam208b T C 13: 3,569,507 I2241M possibly damaging Het
Gin1 T A 1: 97,786,055 L360* probably null Het
Gldc A T 19: 30,143,453 D359E probably damaging Het
Gpr107 A T 2: 31,167,051 T52S possibly damaging Het
Hip1r A G 5: 123,994,820 Y227C probably damaging Het
Hmgxb3 A G 18: 61,135,559 L1004P probably damaging Het
Hspa1l A G 17: 34,977,443 N153D probably damaging Het
Itga8 C A 2: 12,200,163 V488L probably damaging Het
Kcnk10 G A 12: 98,496,288 A134V probably benign Het
Kif18a T A 2: 109,298,403 C406S probably benign Het
Klhl28 A T 12: 64,951,819 S300R probably damaging Het
Kmt2e C T 5: 23,482,453 Q434* probably null Het
Lilrb4a A G 10: 51,496,185 T222A probably benign Het
Lipn G A 19: 34,080,710 R277Q probably damaging Het
Lrrc61 G A 6: 48,568,774 R177Q possibly damaging Het
Lrrc74a G A 12: 86,741,026 E144K probably damaging Het
Mal T C 2: 127,635,044 Y77C probably benign Het
Map1a T A 2: 121,302,655 C1079* probably null Het
Mbd5 T A 2: 49,256,218 S147T possibly damaging Het
Nsd2 T A 5: 33,861,149 M509K probably benign Het
Olfr1342 C T 4: 118,689,948 R168H probably benign Het
Olfr262 C T 19: 12,240,831 V277I probably benign Het
Olfr414 T C 1: 174,431,097 V223A probably benign Het
Olfr51 T C 11: 51,007,637 F222L probably benign Het
Rcor2 C T 19: 7,270,181 L45F probably damaging Het
Rpl12 T A 2: 32,963,525 D107E probably benign Het
Rpl7l1 A T 17: 46,778,191 F205I probably damaging Het
Samd4b C T 7: 28,414,010 G177R probably damaging Het
Sema4a A T 3: 88,454,766 F18I possibly damaging Het
Slc37a1 A T 17: 31,338,074 T405S probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Syt14 T C 1: 192,897,482 D781G probably damaging Het
Tprn T G 2: 25,264,409 D574E probably benign Het
Trim75 T A 8: 64,982,511 E429V probably damaging Het
Trit1 C T 4: 123,054,236 R450C possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Unc13c A G 9: 73,639,050 probably null Het
Usp49 C A 17: 47,673,410 L447I probably damaging Het
Vmn1r20 T C 6: 57,431,952 C88R probably benign Het
Zfp94 T A 7: 24,302,834 K394N probably damaging Het
Other mutations in Adam6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Adam6b APN 12 113491393 missense probably damaging 1.00
IGL00800:Adam6b APN 12 113490442 missense probably benign 0.24
IGL01456:Adam6b APN 12 113491463 missense probably benign 0.30
IGL02232:Adam6b APN 12 113491144 missense probably benign 0.06
IGL03039:Adam6b APN 12 113490882 missense probably damaging 1.00
IGL03399:Adam6b APN 12 113491108 missense probably damaging 0.97
IGL03412:Adam6b APN 12 113491770 nonsense probably null
R0234:Adam6b UTSW 12 113490610 missense probably damaging 0.98
R0234:Adam6b UTSW 12 113490610 missense probably damaging 0.98
R0373:Adam6b UTSW 12 113490655 missense probably benign 0.15
R0402:Adam6b UTSW 12 113489995 missense probably damaging 0.96
R0420:Adam6b UTSW 12 113489994 missense probably benign 0.02
R0573:Adam6b UTSW 12 113491658 missense possibly damaging 0.90
R0884:Adam6b UTSW 12 113490995 missense probably damaging 1.00
R1489:Adam6b UTSW 12 113491451 missense probably benign 0.15
R1542:Adam6b UTSW 12 113490939 missense possibly damaging 0.53
R1591:Adam6b UTSW 12 113489832 missense probably benign 0.07
R1596:Adam6b UTSW 12 113491026 missense probably damaging 1.00
R1699:Adam6b UTSW 12 113490585 missense probably benign 0.02
R1818:Adam6b UTSW 12 113491256 missense probably benign 0.15
R1829:Adam6b UTSW 12 113489925 missense probably damaging 1.00
R1851:Adam6b UTSW 12 113491822 missense probably benign 0.44
R1955:Adam6b UTSW 12 113491816 missense probably benign 0.16
R2040:Adam6b UTSW 12 113490744 missense probably benign 0.34
R3820:Adam6b UTSW 12 113490364 missense probably benign 0.38
R4112:Adam6b UTSW 12 113489636 missense possibly damaging 0.85
R4434:Adam6b UTSW 12 113490661 missense probably damaging 1.00
R4435:Adam6b UTSW 12 113490661 missense probably damaging 1.00
R4437:Adam6b UTSW 12 113490661 missense probably damaging 1.00
R4438:Adam6b UTSW 12 113490661 missense probably damaging 1.00
R4509:Adam6b UTSW 12 113490352 missense probably benign 0.02
R5034:Adam6b UTSW 12 113490927 missense probably damaging 1.00
R5316:Adam6b UTSW 12 113491393 missense probably damaging 1.00
R5330:Adam6b UTSW 12 113490580 missense possibly damaging 0.45
R5331:Adam6b UTSW 12 113490580 missense possibly damaging 0.45
R5604:Adam6b UTSW 12 113490800 nonsense probably null
R5698:Adam6b UTSW 12 113491463 missense probably benign 0.30
R5877:Adam6b UTSW 12 113490202 missense probably damaging 1.00
R6235:Adam6b UTSW 12 113491710 missense probably benign
R6254:Adam6b UTSW 12 113489570 missense probably damaging 0.99
R6371:Adam6b UTSW 12 113490274 missense probably damaging 0.99
R6617:Adam6b UTSW 12 113490532 missense possibly damaging 0.78
R6768:Adam6b UTSW 12 113490243 missense probably benign 0.01
R7002:Adam6b UTSW 12 113489707 nonsense probably null
R7003:Adam6b UTSW 12 113490042 nonsense probably null
R7049:Adam6b UTSW 12 113490502 missense probably damaging 0.99
R7313:Adam6b UTSW 12 113491134 missense probably benign 0.00
R7372:Adam6b UTSW 12 113490164 missense probably benign 0.24
R7684:Adam6b UTSW 12 113491576 nonsense probably null
R7777:Adam6b UTSW 12 113490138 missense possibly damaging 0.93
R7781:Adam6b UTSW 12 113491342 missense probably damaging 1.00
R7857:Adam6b UTSW 12 113490484 missense probably benign 0.09
R7940:Adam6b UTSW 12 113490484 missense probably benign 0.09
RF012:Adam6b UTSW 12 113489932 missense probably damaging 1.00
RF022:Adam6b UTSW 12 113491669 missense possibly damaging 0.90
T0722:Adam6b UTSW 12 113489577 missense possibly damaging 0.91
T0722:Adam6b UTSW 12 113491268 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- AGATCCCTGCTGTGGAAATGATTGC -3'
(R):5'- TGTCCCACGATGTTCATCAAGCC -3'

Sequencing Primer
(F):5'- TGCAGGTTAACACCTGGTAGC -3'
(R):5'- GTGACATTGGTACACTGCAAC -3'
Posted On2014-05-09