Mutagenetix > Incidental Mutation

Incidental Mutation 'R1675:Fam208b'

188018

Institutional Source

Beutler Lab

Gene Symbol

Fam208b

Ensembl Gene

ENSMUSG00000033799

Gene Name

family with sequence similarity 208, member B

Synonyms

BC016423

MMRRC Submission

039711-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.096) question?

Stock #

R1675 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

3566035-3611108 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 3569507 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 2241 (I2241M)

Ref Sequence

ENSEMBL: ENSMUSP00000093774 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059515] [ENSMUST00000096069] [ENSMUST00000223396]

AlphaFold

Q5DTT3

Predicted Effect

probably benign
Transcript: ENSMUST00000059515

SMART Domains

Protein: ENSMUSP00000062996
Gene: ENSMUSG00000021218

Domain	Start	End	E-Value	Type
Pfam:GDI	1	436	4.6e-239	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000096069
AA Change: I2241M

PolyPhen 2 Score 0.651 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000093774
Gene: ENSMUSG00000033799
AA Change: I2241M

Domain	Start	End	E-Value	Type
Pfam:DUF3699	91	167	1.4e-24	PFAM
low complexity region	272	282	N/A	INTRINSIC
low complexity region	447	459	N/A	INTRINSIC
Pfam:DUF3715	533	695	2.3e-25	PFAM
low complexity region	1156	1168	N/A	INTRINSIC
low complexity region	1196	1207	N/A	INTRINSIC
low complexity region	1312	1330	N/A	INTRINSIC
low complexity region	2012	2021	N/A	INTRINSIC
low complexity region	2250	2263	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221059

Predicted Effect

probably benign
Transcript: ENSMUST00000221581

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221629

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222615

Predicted Effect

unknown
Transcript: ENSMUST00000222909
AA Change: I1559M

Predicted Effect

probably benign
Transcript: ENSMUST00000223396

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.5%
20x: 93.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	C	T	1: 71,263,411		probably null	Het
Adam6b	T	C	12: 113,491,044	Y494H	probably benign	Het
Adamtsl2	GC	G	2: 27,082,485		probably null	Het
Anapc2	G	A	2: 25,272,639	V42M	possibly damaging	Het
Aph1a	T	A	3: 95,894,899	D64E	possibly damaging	Het
Arhgef11	C	T	3: 87,731,211	A1111V	possibly damaging	Het
Atoh1	T	C	6: 64,730,157	S279P	probably benign	Het
Atp10b	A	G	11: 43,225,648	T941A	probably damaging	Het
Barhl1	C	T	2: 28,915,411	R90Q	possibly damaging	Het
Calr3	T	C	8: 72,431,458	D91G	probably damaging	Het
Ccdc148	T	C	2: 58,980,554	D317G	probably damaging	Het
Cnn3	C	T	3: 121,457,169	Q19*	probably null	Het
Cul5	T	C	9: 53,646,683	D207G	probably benign	Het
Cyp4x1	T	C	4: 115,127,560	E41G	possibly damaging	Het
Dagla	T	A	19: 10,269,323	M138L	probably benign	Het
Dnah6	A	T	6: 73,129,540	M1738K	probably damaging	Het
Eif4enif1	T	A	11: 3,215,686	S88T	probably benign	Het
Eno3	T	C	11: 70,658,666		probably null	Het
Erbb3	C	A	10: 128,571,204	S1029I	probably damaging	Het
Erbin	C	A	13: 103,841,178	V624L	probably damaging	Het
Fam170b	C	T	14: 32,835,402	Q65*	probably null	Het
Gin1	T	A	1: 97,786,055	L360*	probably null	Het
Gldc	A	T	19: 30,143,453	D359E	probably damaging	Het
Gpr107	A	T	2: 31,167,051	T52S	possibly damaging	Het
Hip1r	A	G	5: 123,994,820	Y227C	probably damaging	Het
Hmgxb3	A	G	18: 61,135,559	L1004P	probably damaging	Het
Hspa1l	A	G	17: 34,977,443	N153D	probably damaging	Het
Itga8	C	A	2: 12,200,163	V488L	probably damaging	Het
Kcnk10	G	A	12: 98,496,288	A134V	probably benign	Het
Kif18a	T	A	2: 109,298,403	C406S	probably benign	Het
Klhl28	A	T	12: 64,951,819	S300R	probably damaging	Het
Kmt2e	C	T	5: 23,482,453	Q434*	probably null	Het
Lilrb4a	A	G	10: 51,496,185	T222A	probably benign	Het
Lipn	G	A	19: 34,080,710	R277Q	probably damaging	Het
Lrrc61	G	A	6: 48,568,774	R177Q	possibly damaging	Het
Lrrc74a	G	A	12: 86,741,026	E144K	probably damaging	Het
Mal	T	C	2: 127,635,044	Y77C	probably benign	Het
Map1a	T	A	2: 121,302,655	C1079*	probably null	Het
Mbd5	T	A	2: 49,256,218	S147T	possibly damaging	Het
Nsd2	T	A	5: 33,861,149	M509K	probably benign	Het
Olfr1342	C	T	4: 118,689,948	R168H	probably benign	Het
Olfr262	C	T	19: 12,240,831	V277I	probably benign	Het
Olfr414	T	C	1: 174,431,097	V223A	probably benign	Het
Olfr51	T	C	11: 51,007,637	F222L	probably benign	Het
Rcor2	C	T	19: 7,270,181	L45F	probably damaging	Het
Rpl12	T	A	2: 32,963,525	D107E	probably benign	Het
Rpl7l1	A	T	17: 46,778,191	F205I	probably damaging	Het
Samd4b	C	T	7: 28,414,010	G177R	probably damaging	Het
Sema4a	A	T	3: 88,454,766	F18I	possibly damaging	Het
Slc37a1	A	T	17: 31,338,074	T405S	probably damaging	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Syt14	T	C	1: 192,897,482	D781G	probably damaging	Het
Tprn	T	G	2: 25,264,409	D574E	probably benign	Het
Trim75	T	A	8: 64,982,511	E429V	probably damaging	Het
Trit1	C	T	4: 123,054,236	R450C	possibly damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Unc13c	A	G	9: 73,639,050		probably null	Het
Usp49	C	A	17: 47,673,410	L447I	probably damaging	Het
Vmn1r20	T	C	6: 57,431,952	C88R	probably benign	Het
Zfp94	T	A	7: 24,302,834	K394N	probably damaging	Het

Other mutations in Fam208b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00330:Fam208b	APN	13	3574832	missense	probably benign
IGL00670:Fam208b	APN	13	3585241	missense	probably benign	0.14
IGL00957:Fam208b	APN	13	3577101	missense	possibly damaging	0.86
IGL01311:Fam208b	APN	13	3575885	missense	possibly damaging	0.85
IGL01318:Fam208b	APN	13	3575067	missense	possibly damaging	0.66
IGL01767:Fam208b	APN	13	3576633	missense	probably benign	0.00
IGL02073:Fam208b	APN	13	3574721	missense	probably benign	0.01
IGL02152:Fam208b	APN	13	3585371	missense	probably benign
IGL02431:Fam208b	APN	13	3574736	missense	possibly damaging	0.85
IGL02478:Fam208b	APN	13	3574661	missense	probably benign	0.12
IGL02732:Fam208b	APN	13	3573626	missense	probably benign	0.09
IGL02745:Fam208b	APN	13	3585140	missense	probably benign	0.23
IGL02800:Fam208b	APN	13	3585154	missense	probably benign
IGL02989:Fam208b	APN	13	3584820	missense	probably benign	0.01
IGL03124:Fam208b	APN	13	3574704	missense	probably benign	0.41
IGL03154:Fam208b	APN	13	3575255	missense	possibly damaging	0.56
IGL03216:Fam208b	APN	13	3574553	missense	probably damaging	0.98
BB001:Fam208b	UTSW	13	3594331	missense	possibly damaging	0.92
BB011:Fam208b	UTSW	13	3594331	missense	possibly damaging	0.92
H8562:Fam208b	UTSW	13	3577000	missense	probably damaging	0.98
PIT4585001:Fam208b	UTSW	13	3574979	missense	possibly damaging	0.55
R0016:Fam208b	UTSW	13	3585170	splice site	probably null
R0016:Fam208b	UTSW	13	3585170	splice site	probably null
R0157:Fam208b	UTSW	13	3575550	missense	probably benign	0.06
R0375:Fam208b	UTSW	13	3596842	missense	possibly damaging	0.85
R0403:Fam208b	UTSW	13	3582052	nonsense	probably null
R0472:Fam208b	UTSW	13	3588364	missense	possibly damaging	0.93
R0517:Fam208b	UTSW	13	3566964	missense	possibly damaging	0.94
R0586:Fam208b	UTSW	13	3590321	missense	probably damaging	0.99
R0600:Fam208b	UTSW	13	3576054	missense	probably benign
R0659:Fam208b	UTSW	13	3574448	missense	probably damaging	0.99
R1257:Fam208b	UTSW	13	3575049	missense	probably benign	0.25
R1375:Fam208b	UTSW	13	3576029	missense	probably benign	0.06
R1443:Fam208b	UTSW	13	3575543	missense	probably benign	0.00
R1497:Fam208b	UTSW	13	3570409	missense	probably damaging	0.96
R1544:Fam208b	UTSW	13	3590413	missense	possibly damaging	0.68
R1554:Fam208b	UTSW	13	3576374	missense	possibly damaging	0.85
R1629:Fam208b	UTSW	13	3574121	missense	possibly damaging	0.84
R1633:Fam208b	UTSW	13	3581771	missense	possibly damaging	0.53
R1661:Fam208b	UTSW	13	3573860	missense	possibly damaging	0.63
R1673:Fam208b	UTSW	13	3584498	critical splice donor site	probably null
R1781:Fam208b	UTSW	13	3584759	missense	possibly damaging	0.95
R1792:Fam208b	UTSW	13	3590559	missense	possibly damaging	0.91
R1826:Fam208b	UTSW	13	3581759	missense	probably damaging	0.98
R1920:Fam208b	UTSW	13	3576612	missense	possibly damaging	0.63
R1983:Fam208b	UTSW	13	3574853	missense	possibly damaging	0.92
R2016:Fam208b	UTSW	13	3576770	missense	probably benign	0.41
R2017:Fam208b	UTSW	13	3576770	missense	probably benign	0.41
R2220:Fam208b	UTSW	13	3581872	missense	probably benign	0.00
R2513:Fam208b	UTSW	13	3582150	missense	possibly damaging	0.53
R2898:Fam208b	UTSW	13	3585122	missense	possibly damaging	0.82
R2904:Fam208b	UTSW	13	3582185	missense	possibly damaging	0.53
R3149:Fam208b	UTSW	13	3574359	missense	probably damaging	0.98
R3623:Fam208b	UTSW	13	3595556	missense	probably benign
R3624:Fam208b	UTSW	13	3595556	missense	probably benign
R3725:Fam208b	UTSW	13	3590538	missense	probably benign	0.33
R3835:Fam208b	UTSW	13	3575292	missense	probably benign	0.01
R3890:Fam208b	UTSW	13	3596785	missense	probably damaging	0.96
R4023:Fam208b	UTSW	13	3584554	missense	probably damaging	0.99
R4024:Fam208b	UTSW	13	3584554	missense	probably damaging	0.99
R4025:Fam208b	UTSW	13	3584554	missense	probably damaging	0.99
R4050:Fam208b	UTSW	13	3573507	missense	probably benign	0.09
R4308:Fam208b	UTSW	13	3569498	missense	probably damaging	0.97
R4484:Fam208b	UTSW	13	3581831	missense	probably benign	0.12
R4674:Fam208b	UTSW	13	3573686	missense	possibly damaging	0.69
R4718:Fam208b	UTSW	13	3574495	missense	probably benign	0.00
R4745:Fam208b	UTSW	13	3590069	missense	probably benign	0.26
R4776:Fam208b	UTSW	13	3570391	missense	probably damaging	1.00
R4839:Fam208b	UTSW	13	3584807	missense	probably damaging	0.96
R4855:Fam208b	UTSW	13	3566680	splice site	probably null
R5049:Fam208b	UTSW	13	3574000	missense	probably benign	0.00
R5076:Fam208b	UTSW	13	3576357	missense	probably benign	0.41
R5287:Fam208b	UTSW	13	3575744	missense	probably benign	0.41
R5298:Fam208b	UTSW	13	3595613	splice site	probably null
R5379:Fam208b	UTSW	13	3588496	missense	probably benign	0.41
R5512:Fam208b	UTSW	13	3595517	missense	probably damaging	0.99
R5624:Fam208b	UTSW	13	3584996	missense	possibly damaging	0.66
R5750:Fam208b	UTSW	13	3573642	nonsense	probably null
R6114:Fam208b	UTSW	13	3590081	missense	probably damaging	1.00
R6118:Fam208b	UTSW	13	3581891	missense	possibly damaging	0.76
R6119:Fam208b	UTSW	13	3581891	missense	possibly damaging	0.76
R6269:Fam208b	UTSW	13	3581891	missense	possibly damaging	0.76
R6270:Fam208b	UTSW	13	3581891	missense	possibly damaging	0.76
R6271:Fam208b	UTSW	13	3581891	missense	possibly damaging	0.76
R6272:Fam208b	UTSW	13	3581891	missense	possibly damaging	0.76
R6525:Fam208b	UTSW	13	3576540	nonsense	probably null
R6550:Fam208b	UTSW	13	3590519	missense	possibly damaging	0.85
R6714:Fam208b	UTSW	13	3594189	missense	probably benign	0.00
R6797:Fam208b	UTSW	13	3576769	missense	probably benign	0.26
R6967:Fam208b	UTSW	13	3574819	missense	probably benign	0.22
R7016:Fam208b	UTSW	13	3576857	missense	possibly damaging	0.92
R7219:Fam208b	UTSW	13	3590521	missense	probably damaging	0.99
R7454:Fam208b	UTSW	13	3585332	missense	probably benign	0.21
R7570:Fam208b	UTSW	13	3573621	missense	probably damaging	0.99
R7571:Fam208b	UTSW	13	3575292	missense	probably benign	0.01
R7580:Fam208b	UTSW	13	3574752	missense	probably damaging	0.99
R7587:Fam208b	UTSW	13	3568849	missense	possibly damaging	0.83
R7657:Fam208b	UTSW	13	3573777	missense	probably damaging	0.98
R7810:Fam208b	UTSW	13	3575714	missense	possibly damaging	0.61
R7909:Fam208b	UTSW	13	3573765	missense	possibly damaging	0.93
R7924:Fam208b	UTSW	13	3594331	missense	possibly damaging	0.92
R7945:Fam208b	UTSW	13	3576085	missense	probably benign
R8005:Fam208b	UTSW	13	3575681	missense	probably benign
R8067:Fam208b	UTSW	13	3569602	missense	probably benign
R8112:Fam208b	UTSW	13	3569516	missense	probably damaging	1.00
R8162:Fam208b	UTSW	13	3599691	missense	probably damaging	0.96
R8170:Fam208b	UTSW	13	3574881	nonsense	probably null
R8240:Fam208b	UTSW	13	3574388	missense	probably benign
R8263:Fam208b	UTSW	13	3575286	missense	possibly damaging	0.70
R8263:Fam208b	UTSW	13	3590016	missense	probably benign	0.03
R8477:Fam208b	UTSW	13	3575079	missense	probably benign	0.18
R9022:Fam208b	UTSW	13	3576659	missense	probably benign
R9140:Fam208b	UTSW	13	3588441	missense	probably benign	0.04
R9167:Fam208b	UTSW	13	3574724	missense	probably benign
R9527:Fam208b	UTSW	13	3585191	missense	possibly damaging	0.61
R9535:Fam208b	UTSW	13	3573559	missense	possibly damaging	0.69
R9711:Fam208b	UTSW	13	3599667	missense	probably benign
X0024:Fam208b	UTSW	13	3599837	missense	probably null	0.99
X0025:Fam208b	UTSW	13	3576827	missense	probably benign	0.15
X0066:Fam208b	UTSW	13	3588441	missense	probably benign	0.04
Z1176:Fam208b	UTSW	13	3576636	missense	probably benign	0.01
Z1176:Fam208b	UTSW	13	3588429	missense	probably damaging	0.98
Z1177:Fam208b	UTSW	13	3574234	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- GCCACTTATGAACAACATTTGTCTCCAC -3'
(R):5'- CATGGGAATGTTAATTGTTGCCTGCAT -3'

Sequencing Primer
(F):5'- gggaaggaactgaaatctgaac -3'
(R):5'- ATGTGCCTTTCCTTATGGAAGTC -3'

Posted On

2014-05-09