Mutagenetix > Incidental Mutations

Incidental Mutation 'R1675:Erbin'

188020

Institutional Source

Beutler Lab

Gene Symbol

Erbin

Ensembl Gene

ENSMUSG00000021709

Gene Name

Erbb2 interacting protein

Synonyms

1700028E05Rik, Erbb2ip, Erbin

MMRRC Submission

039711-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1675 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

103818787-103920514 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 103841178 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 624 (V624L)

Ref Sequence

ENSEMBL: ENSMUSP00000140931 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022222] [ENSMUST00000053927] [ENSMUST00000091269] [ENSMUST00000169083] [ENSMUST00000188997] [ENSMUST00000191275]

Predicted Effect

probably damaging
Transcript: ENSMUST00000022222
AA Change: V624L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000022222
Gene: ENSMUSG00000021709
AA Change: V624L

Domain	Start	End	E-Value	Type
LRR	48	68	3.65e0	SMART
LRR	91	114	4.97e0	SMART
LRR	137	159	4.21e1	SMART
LRR	160	182	8.97e0	SMART
LRR	183	205	1.41e0	SMART
LRR	206	228	3.87e1	SMART
LRR	229	252	1.31e0	SMART
LRR	253	274	3.56e2	SMART
LRR	275	298	1.19e1	SMART
LRR	321	344	2.76e1	SMART
LRR	345	366	3.27e2	SMART
LRR	367	389	1.06e1	SMART
low complexity region	534	544	N/A	INTRINSIC
low complexity region	593	603	N/A	INTRINSIC
low complexity region	625	642	N/A	INTRINSIC
low complexity region	647	659	N/A	INTRINSIC
PDZ	1294	1374	3.6e-16	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000053927
AA Change: V624L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000057956
Gene: ENSMUSG00000021709
AA Change: V624L

Domain	Start	End	E-Value	Type
LRR	48	68	3.65e0	SMART
LRR	91	114	4.97e0	SMART
LRR	137	159	4.21e1	SMART
LRR	160	182	8.97e0	SMART
LRR	183	205	1.41e0	SMART
LRR	206	228	3.87e1	SMART
LRR	229	252	1.31e0	SMART
LRR	253	274	3.56e2	SMART
LRR	275	298	1.19e1	SMART
LRR	321	344	2.76e1	SMART
LRR	345	366	3.27e2	SMART
LRR	367	389	1.06e1	SMART
low complexity region	534	544	N/A	INTRINSIC
low complexity region	593	603	N/A	INTRINSIC
low complexity region	625	642	N/A	INTRINSIC
low complexity region	647	659	N/A	INTRINSIC
PDZ	1368	1448	3.6e-16	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000091269
AA Change: V624L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000088813
Gene: ENSMUSG00000021709
AA Change: V624L

Domain	Start	End	E-Value	Type
LRR	48	68	3.65e0	SMART
LRR	91	114	4.97e0	SMART
LRR	137	159	4.21e1	SMART
LRR	160	182	8.97e0	SMART
LRR	183	205	1.41e0	SMART
LRR	206	228	3.87e1	SMART
LRR	229	252	1.31e0	SMART
LRR	253	274	3.56e2	SMART
LRR	275	298	1.19e1	SMART
LRR	321	344	2.76e1	SMART
LRR	345	366	3.27e2	SMART
LRR	367	389	1.06e1	SMART
low complexity region	534	544	N/A	INTRINSIC
low complexity region	593	603	N/A	INTRINSIC
low complexity region	625	642	N/A	INTRINSIC
low complexity region	647	659	N/A	INTRINSIC
PDZ	1320	1400	3.6e-16	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000169083
AA Change: V624L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000127607
Gene: ENSMUSG00000021709
AA Change: V624L

Domain	Start	End	E-Value	Type
LRR	48	68	3.65e0	SMART
LRR	91	114	4.97e0	SMART
LRR	137	159	4.21e1	SMART
LRR	160	182	8.97e0	SMART
LRR	183	205	1.41e0	SMART
LRR	206	228	3.87e1	SMART
LRR	229	252	1.31e0	SMART
LRR	253	274	3.56e2	SMART
LRR	275	298	1.19e1	SMART
LRR	321	344	2.76e1	SMART
LRR	345	366	3.27e2	SMART
LRR	367	389	1.06e1	SMART
low complexity region	534	544	N/A	INTRINSIC
low complexity region	593	603	N/A	INTRINSIC
low complexity region	625	642	N/A	INTRINSIC
low complexity region	647	659	N/A	INTRINSIC
PDZ	1329	1409	3.6e-16	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000188997
AA Change: V624L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140931
Gene: ENSMUSG00000021709
AA Change: V624L

Domain	Start	End	E-Value	Type
LRR	48	68	3.65e0	SMART
LRR	91	114	4.97e0	SMART
LRR	137	159	4.21e1	SMART
LRR	160	182	8.97e0	SMART
LRR	183	205	1.41e0	SMART
LRR	206	228	3.87e1	SMART
LRR	229	252	1.31e0	SMART
LRR	253	274	3.56e2	SMART
LRR	275	298	1.19e1	SMART
LRR	321	344	2.76e1	SMART
LRR	345	366	3.27e2	SMART
LRR	367	389	1.06e1	SMART
low complexity region	534	544	N/A	INTRINSIC
low complexity region	593	603	N/A	INTRINSIC
low complexity region	625	642	N/A	INTRINSIC
low complexity region	647	659	N/A	INTRINSIC
PDZ	1212	1292	3.6e-16	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189323

Predicted Effect

probably damaging
Transcript: ENSMUST00000191275
AA Change: V624L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000140536
Gene: ENSMUSG00000021709
AA Change: V624L

Domain	Start	End	E-Value	Type
LRR	48	68	3.65e0	SMART
LRR	91	114	4.97e0	SMART
LRR	137	159	4.21e1	SMART
LRR	160	182	8.97e0	SMART
LRR	183	205	1.41e0	SMART
LRR	206	228	3.87e1	SMART
LRR	229	252	1.31e0	SMART
LRR	253	274	3.56e2	SMART
LRR	275	298	1.19e1	SMART
LRR	321	344	2.76e1	SMART
LRR	345	366	3.27e2	SMART
LRR	367	389	1.06e1	SMART
low complexity region	534	544	N/A	INTRINSIC
low complexity region	593	603	N/A	INTRINSIC
low complexity region	625	642	N/A	INTRINSIC
low complexity region	647	659	N/A	INTRINSIC
PDZ	1368	1448	3.6e-16	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.5%
20x: 93.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the leucine-rich repeat and PDZ domain (LAP) family. The encoded protein contains 17 leucine-rich repeats and one PDZ domain. It binds to the unphosphorylated form of the ERBB2 protein and regulates ERBB2 function and localization. It has also been shown to affect the Ras signaling pathway by disrupting Ras-Raf interaction. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a null or gene trapped allele exhibit impaired myelination, reduced nerve conduction, and hyporesponsiveness to tactile stimuli. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	C	T	1: 71,263,411		probably null	Het
Adam6b	T	C	12: 113,491,044	Y494H	probably benign	Het
Adamtsl2	GC	G	2: 27,082,485		probably null	Het
Anapc2	G	A	2: 25,272,639	V42M	possibly damaging	Het
Aph1a	T	A	3: 95,894,899	D64E	possibly damaging	Het
Arhgef11	C	T	3: 87,731,211	A1111V	possibly damaging	Het
Atoh1	T	C	6: 64,730,157	S279P	probably benign	Het
Atp10b	A	G	11: 43,225,648	T941A	probably damaging	Het
Barhl1	C	T	2: 28,915,411	R90Q	possibly damaging	Het
Calr3	T	C	8: 72,431,458	D91G	probably damaging	Het
Ccdc148	T	C	2: 58,980,554	D317G	probably damaging	Het
Cnn3	C	T	3: 121,457,169	Q19*	probably null	Het
Cul5	T	C	9: 53,646,683	D207G	probably benign	Het
Cyp4x1	T	C	4: 115,127,560	E41G	possibly damaging	Het
Dagla	T	A	19: 10,269,323	M138L	probably benign	Het
Dnah6	A	T	6: 73,129,540	M1738K	probably damaging	Het
Eif4enif1	T	A	11: 3,215,686	S88T	probably benign	Het
Eno3	T	C	11: 70,658,666		probably null	Het
Erbb3	C	A	10: 128,571,204	S1029I	probably damaging	Het
Fam170b	C	T	14: 32,835,402	Q65*	probably null	Het
Fam208b	T	C	13: 3,569,507	I2241M	possibly damaging	Het
Gin1	T	A	1: 97,786,055	L360*	probably null	Het
Gldc	A	T	19: 30,143,453	D359E	probably damaging	Het
Gpr107	A	T	2: 31,167,051	T52S	possibly damaging	Het
Hip1r	A	G	5: 123,994,820	Y227C	probably damaging	Het
Hmgxb3	A	G	18: 61,135,559	L1004P	probably damaging	Het
Hspa1l	A	G	17: 34,977,443	N153D	probably damaging	Het
Itga8	C	A	2: 12,200,163	V488L	probably damaging	Het
Kcnk10	G	A	12: 98,496,288	A134V	probably benign	Het
Kif18a	T	A	2: 109,298,403	C406S	probably benign	Het
Klhl28	A	T	12: 64,951,819	S300R	probably damaging	Het
Kmt2e	C	T	5: 23,482,453	Q434*	probably null	Het
Lilrb4a	A	G	10: 51,496,185	T222A	probably benign	Het
Lipn	G	A	19: 34,080,710	R277Q	probably damaging	Het
Lrrc61	G	A	6: 48,568,774	R177Q	possibly damaging	Het
Lrrc74a	G	A	12: 86,741,026	E144K	probably damaging	Het
Mal	T	C	2: 127,635,044	Y77C	probably benign	Het
Map1a	T	A	2: 121,302,655	C1079*	probably null	Het
Mbd5	T	A	2: 49,256,218	S147T	possibly damaging	Het
Nsd2	T	A	5: 33,861,149	M509K	probably benign	Het
Olfr1342	C	T	4: 118,689,948	R168H	probably benign	Het
Olfr262	C	T	19: 12,240,831	V277I	probably benign	Het
Olfr414	T	C	1: 174,431,097	V223A	probably benign	Het
Olfr51	T	C	11: 51,007,637	F222L	probably benign	Het
Rcor2	C	T	19: 7,270,181	L45F	probably damaging	Het
Rpl12	T	A	2: 32,963,525	D107E	probably benign	Het
Rpl7l1	A	T	17: 46,778,191	F205I	probably damaging	Het
Samd4b	C	T	7: 28,414,010	G177R	probably damaging	Het
Sema4a	A	T	3: 88,454,766	F18I	possibly damaging	Het
Slc37a1	A	T	17: 31,338,074	T405S	probably damaging	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Syt14	T	C	1: 192,897,482	D781G	probably damaging	Het
Tprn	T	G	2: 25,264,409	D574E	probably benign	Het
Trim75	T	A	8: 64,982,511	E429V	probably damaging	Het
Trit1	C	T	4: 123,054,236	R450C	possibly damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Unc13c	A	G	9: 73,639,050		probably null	Het
Usp49	C	A	17: 47,673,410	L447I	probably damaging	Het
Vmn1r20	T	C	6: 57,431,952	C88R	probably benign	Het
Zfp94	T	A	7: 24,302,834	K394N	probably damaging	Het

Other mutations in Erbin

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01092:Erbin	APN	13	103834012	missense	probably damaging	1.00
IGL01404:Erbin	APN	13	103839464	missense	probably damaging	1.00
IGL01455:Erbin	APN	13	103859387	missense	probably damaging	1.00
IGL01871:Erbin	APN	13	103834766	missense	probably damaging	0.98
IGL01930:Erbin	APN	13	103841172	missense	probably damaging	1.00
IGL02112:Erbin	APN	13	103862336	missense	probably benign	0.12
IGL02736:Erbin	APN	13	103839395	missense	probably damaging	1.00
IGL03149:Erbin	APN	13	103841163	missense	possibly damaging	0.82
IGL03169:Erbin	APN	13	103841232	missense	possibly damaging	0.93
IGL02802:Erbin	UTSW	13	103868130	missense	probably damaging	1.00
PIT1430001:Erbin	UTSW	13	103859509	missense	probably damaging	1.00
R0329:Erbin	UTSW	13	103868865	missense	probably damaging	1.00
R0330:Erbin	UTSW	13	103868865	missense	probably damaging	1.00
R0492:Erbin	UTSW	13	103834358	missense	probably damaging	0.98
R0508:Erbin	UTSW	13	103834027	missense	probably damaging	1.00
R0589:Erbin	UTSW	13	103886287	missense	probably damaging	1.00
R1103:Erbin	UTSW	13	103886202	missense	probably benign	0.00
R1139:Erbin	UTSW	13	103884253	missense	probably damaging	1.00
R1316:Erbin	UTSW	13	103841234	missense	possibly damaging	0.94
R1698:Erbin	UTSW	13	103833731	missense	possibly damaging	0.91
R1727:Erbin	UTSW	13	103827968	missense	probably benign	0.01
R1745:Erbin	UTSW	13	103839449	missense	probably damaging	1.00
R1746:Erbin	UTSW	13	103850831	missense	probably damaging	1.00
R1764:Erbin	UTSW	13	103843451	splice site	probably benign
R1828:Erbin	UTSW	13	103860069	critical splice donor site	probably null
R1840:Erbin	UTSW	13	103834947	missense	probably benign	0.01
R1987:Erbin	UTSW	13	103886203	missense	probably benign	0.36
R1992:Erbin	UTSW	13	103833713	missense	probably benign	0.33
R2013:Erbin	UTSW	13	103857533	missense	probably damaging	1.00
R2025:Erbin	UTSW	13	103830195	missense	probably benign	0.01
R2056:Erbin	UTSW	13	103830316	missense	probably benign	0.27
R2171:Erbin	UTSW	13	103834958	missense	probably benign	0.00
R2366:Erbin	UTSW	13	103844909	missense	probably damaging	1.00
R2897:Erbin	UTSW	13	103886197	missense	probably damaging	1.00
R3912:Erbin	UTSW	13	103862287	missense	probably benign	0.35
R3912:Erbin	UTSW	13	103886338	splice site	probably benign
R4073:Erbin	UTSW	13	103860111	missense	probably damaging	1.00
R4458:Erbin	UTSW	13	103833557	missense	probably damaging	1.00
R4465:Erbin	UTSW	13	103844885	missense	probably benign	0.05
R4525:Erbin	UTSW	13	103857092	missense	probably benign
R4780:Erbin	UTSW	13	103884206	missense	probably damaging	1.00
R4877:Erbin	UTSW	13	103850838	missense	probably damaging	0.99
R4879:Erbin	UTSW	13	103834774	missense	probably benign	0.05
R5396:Erbin	UTSW	13	103857409	critical splice donor site	probably null
R5898:Erbin	UTSW	13	103839305	critical splice donor site	probably null
R5955:Erbin	UTSW	13	103830192	missense	probably benign	0.40
R6073:Erbin	UTSW	13	103844921	nonsense	probably null
R6107:Erbin	UTSW	13	103833892	missense	probably benign	0.06
R6257:Erbin	UTSW	13	103862288	missense	probably benign	0.35
R6294:Erbin	UTSW	13	103857056	missense	probably benign	0.36
R6358:Erbin	UTSW	13	103845565	missense	probably damaging	1.00
R6476:Erbin	UTSW	13	103841247	missense	probably damaging	1.00
R6485:Erbin	UTSW	13	103868113	missense	probably damaging	1.00
R6631:Erbin	UTSW	13	103824892	missense	probably benign	0.02
R6735:Erbin	UTSW	13	103884210	missense	probably damaging	1.00
R6736:Erbin	UTSW	13	103834766	missense	possibly damaging	0.72
R6749:Erbin	UTSW	13	103834377	missense	probably damaging	1.00
R7290:Erbin	UTSW	13	103862326	missense	probably damaging	1.00
R7767:Erbin	UTSW	13	103859399	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCCTTACAAACAAACTCTGCATGG -3'
(R):5'- TGTTTGCCAGTAACCTCACACTCTG -3'

Sequencing Primer
(F):5'- ACAAACTCTGCATGGGAGTG -3'
(R):5'- GAGTCATGCAGCTTTGTCAAC -3'

Posted On

2014-05-09