Incidental Mutation 'R1675:Hspa1l'
ID188024
Institutional Source Beutler Lab
Gene Symbol Hspa1l
Ensembl Gene ENSMUSG00000007033
Gene Nameheat shock protein 1-like
Synonyms70kDa, Msh5, Hsc70t
MMRRC Submission 039711-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.664) question?
Stock #R1675 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location34972703-34979285 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34977443 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 153 (N153D)
Ref Sequence ENSEMBL: ENSMUSP00000007248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007248] [ENSMUST00000007266] [ENSMUST00000114011] [ENSMUST00000173004]
Predicted Effect probably damaging
Transcript: ENSMUST00000007248
AA Change: N153D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000007248
Gene: ENSMUSG00000007033
AA Change: N153D

DomainStartEndE-ValueType
Pfam:HSP70 8 614 6.5e-269 PFAM
low complexity region 616 629 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000007266
SMART Domains Protein: ENSMUSP00000007266
Gene: ENSMUSG00000007050

DomainStartEndE-ValueType
Sm 41 108 8.91e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114011
SMART Domains Protein: ENSMUSP00000109644
Gene: ENSMUSG00000007050

DomainStartEndE-ValueType
Sm 5 72 8.91e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151136
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172777
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172890
Predicted Effect probably benign
Transcript: ENSMUST00000173004
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174241
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174326
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174860
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 70kDa heat shock protein. In conjunction with other heat shock proteins, this protein stabilizes existing proteins against aggregation and mediates the folding of newly translated proteins in the cytosol and in organelles. The gene is located in the major histocompatibility complex class III region, in a cluster with two closely related genes which also encode isoforms of the 70kDa heat shock protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,263,411 probably null Het
Adam6b T C 12: 113,491,044 Y494H probably benign Het
Adamtsl2 GC G 2: 27,082,485 probably null Het
Anapc2 G A 2: 25,272,639 V42M possibly damaging Het
Aph1a T A 3: 95,894,899 D64E possibly damaging Het
Arhgef11 C T 3: 87,731,211 A1111V possibly damaging Het
Atoh1 T C 6: 64,730,157 S279P probably benign Het
Atp10b A G 11: 43,225,648 T941A probably damaging Het
Barhl1 C T 2: 28,915,411 R90Q possibly damaging Het
Calr3 T C 8: 72,431,458 D91G probably damaging Het
Ccdc148 T C 2: 58,980,554 D317G probably damaging Het
Cnn3 C T 3: 121,457,169 Q19* probably null Het
Cul5 T C 9: 53,646,683 D207G probably benign Het
Cyp4x1 T C 4: 115,127,560 E41G possibly damaging Het
Dagla T A 19: 10,269,323 M138L probably benign Het
Dnah6 A T 6: 73,129,540 M1738K probably damaging Het
Eif4enif1 T A 11: 3,215,686 S88T probably benign Het
Eno3 T C 11: 70,658,666 probably null Het
Erbb3 C A 10: 128,571,204 S1029I probably damaging Het
Erbin C A 13: 103,841,178 V624L probably damaging Het
Fam170b C T 14: 32,835,402 Q65* probably null Het
Fam208b T C 13: 3,569,507 I2241M possibly damaging Het
Gin1 T A 1: 97,786,055 L360* probably null Het
Gldc A T 19: 30,143,453 D359E probably damaging Het
Gpr107 A T 2: 31,167,051 T52S possibly damaging Het
Hip1r A G 5: 123,994,820 Y227C probably damaging Het
Hmgxb3 A G 18: 61,135,559 L1004P probably damaging Het
Itga8 C A 2: 12,200,163 V488L probably damaging Het
Kcnk10 G A 12: 98,496,288 A134V probably benign Het
Kif18a T A 2: 109,298,403 C406S probably benign Het
Klhl28 A T 12: 64,951,819 S300R probably damaging Het
Kmt2e C T 5: 23,482,453 Q434* probably null Het
Lilrb4a A G 10: 51,496,185 T222A probably benign Het
Lipn G A 19: 34,080,710 R277Q probably damaging Het
Lrrc61 G A 6: 48,568,774 R177Q possibly damaging Het
Lrrc74a G A 12: 86,741,026 E144K probably damaging Het
Mal T C 2: 127,635,044 Y77C probably benign Het
Map1a T A 2: 121,302,655 C1079* probably null Het
Mbd5 T A 2: 49,256,218 S147T possibly damaging Het
Nsd2 T A 5: 33,861,149 M509K probably benign Het
Olfr1342 C T 4: 118,689,948 R168H probably benign Het
Olfr262 C T 19: 12,240,831 V277I probably benign Het
Olfr414 T C 1: 174,431,097 V223A probably benign Het
Olfr51 T C 11: 51,007,637 F222L probably benign Het
Rcor2 C T 19: 7,270,181 L45F probably damaging Het
Rpl12 T A 2: 32,963,525 D107E probably benign Het
Rpl7l1 A T 17: 46,778,191 F205I probably damaging Het
Samd4b C T 7: 28,414,010 G177R probably damaging Het
Sema4a A T 3: 88,454,766 F18I possibly damaging Het
Slc37a1 A T 17: 31,338,074 T405S probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Syt14 T C 1: 192,897,482 D781G probably damaging Het
Tprn T G 2: 25,264,409 D574E probably benign Het
Trim75 T A 8: 64,982,511 E429V probably damaging Het
Trit1 C T 4: 123,054,236 R450C possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Unc13c A G 9: 73,639,050 probably null Het
Usp49 C A 17: 47,673,410 L447I probably damaging Het
Vmn1r20 T C 6: 57,431,952 C88R probably benign Het
Zfp94 T A 7: 24,302,834 K394N probably damaging Het
Other mutations in Hspa1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Hspa1l APN 17 34977465 missense probably damaging 1.00
IGL01548:Hspa1l APN 17 34978391 missense probably damaging 0.98
IGL01860:Hspa1l APN 17 34978811 missense probably benign 0.00
IGL01959:Hspa1l APN 17 34977135 missense probably damaging 1.00
IGL02661:Hspa1l APN 17 34977275 missense probably benign
R0355:Hspa1l UTSW 17 34977410 missense probably benign
R0850:Hspa1l UTSW 17 34977623 missense probably benign 0.01
R2148:Hspa1l UTSW 17 34977390 missense probably damaging 0.98
R2169:Hspa1l UTSW 17 34977323 missense probably benign
R2418:Hspa1l UTSW 17 34977188 missense probably benign 0.05
R4323:Hspa1l UTSW 17 34977856 nonsense probably null
R4924:Hspa1l UTSW 17 34977856 nonsense probably null
R4926:Hspa1l UTSW 17 34978223 missense possibly damaging 0.92
R5186:Hspa1l UTSW 17 34978469 missense probably damaging 0.97
R5653:Hspa1l UTSW 17 34977420 missense probably damaging 1.00
R5790:Hspa1l UTSW 17 34977240 missense probably benign 0.08
R6086:Hspa1l UTSW 17 34978155 missense possibly damaging 0.77
R6237:Hspa1l UTSW 17 34977452 nonsense probably null
R7229:Hspa1l UTSW 17 34977255 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AAGGTGGAGATCATCGCCAACG -3'
(R):5'- ATCGTCAGGATGGACACGTCGAAC -3'

Sequencing Primer
(F):5'- ATCCCCAGAACACTGTTTTTGATG -3'
(R):5'- ACGTCGAACGTGCCACC -3'
Posted On2014-05-09