Incidental Mutation 'R1675:Hspa1l'
ID 188024
Institutional Source Beutler Lab
Gene Symbol Hspa1l
Ensembl Gene ENSMUSG00000007033
Gene Name heat shock protein 1-like
Synonyms 70kDa, Hsc70t, Msh5
MMRRC Submission 039711-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.716) question?
Stock # R1675 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 35191679-35198204 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 35196419 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 153 (N153D)
Ref Sequence ENSEMBL: ENSMUSP00000007248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007248] [ENSMUST00000007266] [ENSMUST00000114011] [ENSMUST00000173004]
AlphaFold P16627
Predicted Effect probably damaging
Transcript: ENSMUST00000007248
AA Change: N153D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000007248
Gene: ENSMUSG00000007033
AA Change: N153D

DomainStartEndE-ValueType
Pfam:HSP70 8 614 6.5e-269 PFAM
low complexity region 616 629 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000007266
SMART Domains Protein: ENSMUSP00000007266
Gene: ENSMUSG00000007050

DomainStartEndE-ValueType
Sm 41 108 8.91e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114011
SMART Domains Protein: ENSMUSP00000109644
Gene: ENSMUSG00000007050

DomainStartEndE-ValueType
Sm 5 72 8.91e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151136
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172777
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174326
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172890
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174241
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174860
Predicted Effect probably benign
Transcript: ENSMUST00000173004
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 70kDa heat shock protein. In conjunction with other heat shock proteins, this protein stabilizes existing proteins against aggregation and mediates the folding of newly translated proteins in the cytosol and in organelles. The gene is located in the major histocompatibility complex class III region, in a cluster with two closely related genes which also encode isoforms of the 70kDa heat shock protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,302,570 (GRCm39) probably null Het
Adam6b T C 12: 113,454,664 (GRCm39) Y494H probably benign Het
Adamtsl2 GC G 2: 26,972,497 (GRCm39) probably null Het
Anapc2 G A 2: 25,162,651 (GRCm39) V42M possibly damaging Het
Aph1a T A 3: 95,802,211 (GRCm39) D64E possibly damaging Het
Arhgef11 C T 3: 87,638,518 (GRCm39) A1111V possibly damaging Het
Atoh1 T C 6: 64,707,141 (GRCm39) S279P probably benign Het
Atp10b A G 11: 43,116,475 (GRCm39) T941A probably damaging Het
Barhl1 C T 2: 28,805,423 (GRCm39) R90Q possibly damaging Het
Calr3 T C 8: 73,185,302 (GRCm39) D91G probably damaging Het
Ccdc148 T C 2: 58,870,566 (GRCm39) D317G probably damaging Het
Cnn3 C T 3: 121,250,818 (GRCm39) Q19* probably null Het
Cul5 T C 9: 53,557,983 (GRCm39) D207G probably benign Het
Cyp4x1 T C 4: 114,984,757 (GRCm39) E41G possibly damaging Het
Dagla T A 19: 10,246,687 (GRCm39) M138L probably benign Het
Dnah6 A T 6: 73,106,523 (GRCm39) M1738K probably damaging Het
Eif4enif1 T A 11: 3,165,686 (GRCm39) S88T probably benign Het
Eno3 T C 11: 70,549,492 (GRCm39) probably null Het
Erbb3 C A 10: 128,407,073 (GRCm39) S1029I probably damaging Het
Erbin C A 13: 103,977,686 (GRCm39) V624L probably damaging Het
Fam170b C T 14: 32,557,359 (GRCm39) Q65* probably null Het
Gin1 T A 1: 97,713,780 (GRCm39) L360* probably null Het
Gldc A T 19: 30,120,853 (GRCm39) D359E probably damaging Het
Gpr107 A T 2: 31,057,063 (GRCm39) T52S possibly damaging Het
Hip1r A G 5: 124,132,883 (GRCm39) Y227C probably damaging Het
Hmgxb3 A G 18: 61,268,631 (GRCm39) L1004P probably damaging Het
Itga8 C A 2: 12,204,974 (GRCm39) V488L probably damaging Het
Kcnk10 G A 12: 98,462,547 (GRCm39) A134V probably benign Het
Kif18a T A 2: 109,128,748 (GRCm39) C406S probably benign Het
Klhl28 A T 12: 64,998,593 (GRCm39) S300R probably damaging Het
Kmt2e C T 5: 23,687,451 (GRCm39) Q434* probably null Het
Lilrb4a A G 10: 51,372,281 (GRCm39) T222A probably benign Het
Lipn G A 19: 34,058,110 (GRCm39) R277Q probably damaging Het
Lrrc61 G A 6: 48,545,708 (GRCm39) R177Q possibly damaging Het
Lrrc74a G A 12: 86,787,800 (GRCm39) E144K probably damaging Het
Mal T C 2: 127,476,964 (GRCm39) Y77C probably benign Het
Map1a T A 2: 121,133,136 (GRCm39) C1079* probably null Het
Mbd5 T A 2: 49,146,230 (GRCm39) S147T possibly damaging Het
Nsd2 T A 5: 34,018,493 (GRCm39) M509K probably benign Het
Or13p4 C T 4: 118,547,145 (GRCm39) R168H probably benign Het
Or1ad8 T C 11: 50,898,464 (GRCm39) F222L probably benign Het
Or5an1c C T 19: 12,218,195 (GRCm39) V277I probably benign Het
Or6p1 T C 1: 174,258,663 (GRCm39) V223A probably benign Het
Rcor2 C T 19: 7,247,546 (GRCm39) L45F probably damaging Het
Rpl12 T A 2: 32,853,537 (GRCm39) D107E probably benign Het
Rpl7l1 A T 17: 47,089,117 (GRCm39) F205I probably damaging Het
Samd4b C T 7: 28,113,435 (GRCm39) G177R probably damaging Het
Sema4a A T 3: 88,362,073 (GRCm39) F18I possibly damaging Het
Slc37a1 A T 17: 31,557,048 (GRCm39) T405S probably damaging Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Syt14 T C 1: 192,579,790 (GRCm39) D781G probably damaging Het
Tasor2 T C 13: 3,619,507 (GRCm39) I2241M possibly damaging Het
Tprn T G 2: 25,154,421 (GRCm39) D574E probably benign Het
Trim75 T A 8: 65,435,163 (GRCm39) E429V probably damaging Het
Trit1 C T 4: 122,948,029 (GRCm39) R450C possibly damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Unc13c A G 9: 73,546,332 (GRCm39) probably null Het
Usp49 C A 17: 47,984,335 (GRCm39) L447I probably damaging Het
Vmn1r20 T C 6: 57,408,937 (GRCm39) C88R probably benign Het
Zfp94 T A 7: 24,002,259 (GRCm39) K394N probably damaging Het
Other mutations in Hspa1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Hspa1l APN 17 35,196,441 (GRCm39) missense probably damaging 1.00
IGL01548:Hspa1l APN 17 35,197,367 (GRCm39) missense probably damaging 0.98
IGL01860:Hspa1l APN 17 35,197,787 (GRCm39) missense probably benign 0.00
IGL01959:Hspa1l APN 17 35,196,111 (GRCm39) missense probably damaging 1.00
IGL02661:Hspa1l APN 17 35,196,251 (GRCm39) missense probably benign
R0355:Hspa1l UTSW 17 35,196,386 (GRCm39) missense probably benign
R0850:Hspa1l UTSW 17 35,196,599 (GRCm39) missense probably benign 0.01
R2148:Hspa1l UTSW 17 35,196,366 (GRCm39) missense probably damaging 0.98
R2169:Hspa1l UTSW 17 35,196,299 (GRCm39) missense probably benign
R2418:Hspa1l UTSW 17 35,196,164 (GRCm39) missense probably benign 0.05
R4323:Hspa1l UTSW 17 35,196,832 (GRCm39) nonsense probably null
R4924:Hspa1l UTSW 17 35,196,832 (GRCm39) nonsense probably null
R4926:Hspa1l UTSW 17 35,197,199 (GRCm39) missense possibly damaging 0.92
R5186:Hspa1l UTSW 17 35,197,445 (GRCm39) missense probably damaging 0.97
R5653:Hspa1l UTSW 17 35,196,396 (GRCm39) missense probably damaging 1.00
R5790:Hspa1l UTSW 17 35,196,216 (GRCm39) missense probably benign 0.08
R6086:Hspa1l UTSW 17 35,197,131 (GRCm39) missense possibly damaging 0.77
R6237:Hspa1l UTSW 17 35,196,428 (GRCm39) nonsense probably null
R7229:Hspa1l UTSW 17 35,196,231 (GRCm39) missense probably benign 0.05
R8871:Hspa1l UTSW 17 35,197,799 (GRCm39) missense probably benign 0.42
R8952:Hspa1l UTSW 17 35,196,946 (GRCm39) missense probably benign
R8968:Hspa1l UTSW 17 35,196,230 (GRCm39) missense possibly damaging 0.83
R8984:Hspa1l UTSW 17 35,197,092 (GRCm39) missense probably damaging 0.99
R9056:Hspa1l UTSW 17 35,196,849 (GRCm39) missense probably benign 0.16
R9479:Hspa1l UTSW 17 35,196,735 (GRCm39) missense probably benign 0.05
R9520:Hspa1l UTSW 17 35,196,972 (GRCm39) missense probably damaging 1.00
Z1176:Hspa1l UTSW 17 35,197,468 (GRCm39) missense possibly damaging 0.52
Z1177:Hspa1l UTSW 17 35,196,992 (GRCm39) missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- AAGGTGGAGATCATCGCCAACG -3'
(R):5'- ATCGTCAGGATGGACACGTCGAAC -3'

Sequencing Primer
(F):5'- ATCCCCAGAACACTGTTTTTGATG -3'
(R):5'- ACGTCGAACGTGCCACC -3'
Posted On 2014-05-09