Incidental Mutation 'R1675:Hmgxb3'
ID188027
Institutional Source Beutler Lab
Gene Symbol Hmgxb3
Ensembl Gene ENSMUSG00000024622
Gene NameHMG box domain containing 3
Synonyms2510002C16Rik, A630042L21Rik
MMRRC Submission 039711-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.743) question?
Stock #R1675 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location61131279-61177050 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 61135559 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1004 (L1004P)
Ref Sequence ENSEMBL: ENSMUSP00000089498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025523] [ENSMUST00000091884] [ENSMUST00000115268]
Predicted Effect probably benign
Transcript: ENSMUST00000025523
SMART Domains Protein: ENSMUSP00000025523
Gene: ENSMUSG00000024621

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 102 4.63e-8 SMART
IG 112 196 7.82e-6 SMART
IGc2 215 285 1.36e-5 SMART
IG 308 397 3.2e-2 SMART
IG_like 402 504 1.8e2 SMART
transmembrane domain 513 535 N/A INTRINSIC
TyrKc 580 908 1.45e-134 SMART
low complexity region 926 954 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000091884
AA Change: L1004P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089498
Gene: ENSMUSG00000024622
AA Change: L1004P

DomainStartEndE-ValueType
HMG 40 110 6.8e-15 SMART
low complexity region 182 194 N/A INTRINSIC
internal_repeat_1 307 336 1.98e-9 PROSPERO
internal_repeat_1 583 612 1.98e-9 PROSPERO
low complexity region 817 830 N/A INTRINSIC
low complexity region 966 977 N/A INTRINSIC
low complexity region 1239 1254 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115268
SMART Domains Protein: ENSMUSP00000110923
Gene: ENSMUSG00000024621

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 102 4.63e-8 SMART
IG 112 196 7.82e-6 SMART
IGc2 215 285 1.36e-5 SMART
IG 308 397 3.2e-2 SMART
IG_like 402 504 1.8e2 SMART
transmembrane domain 513 535 N/A INTRINSIC
TyrKc 580 908 1.45e-134 SMART
low complexity region 926 954 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158500
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of the non-canonical high mobility group (HMG) genes. The encoded protein contains an HMG-box domain found in DNA binding proteins such as transcription factors and chromosomal proteins. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,263,411 probably null Het
Adam6b T C 12: 113,491,044 Y494H probably benign Het
Adamtsl2 GC G 2: 27,082,485 probably null Het
Anapc2 G A 2: 25,272,639 V42M possibly damaging Het
Aph1a T A 3: 95,894,899 D64E possibly damaging Het
Arhgef11 C T 3: 87,731,211 A1111V possibly damaging Het
Atoh1 T C 6: 64,730,157 S279P probably benign Het
Atp10b A G 11: 43,225,648 T941A probably damaging Het
Barhl1 C T 2: 28,915,411 R90Q possibly damaging Het
Calr3 T C 8: 72,431,458 D91G probably damaging Het
Ccdc148 T C 2: 58,980,554 D317G probably damaging Het
Cnn3 C T 3: 121,457,169 Q19* probably null Het
Cul5 T C 9: 53,646,683 D207G probably benign Het
Cyp4x1 T C 4: 115,127,560 E41G possibly damaging Het
Dagla T A 19: 10,269,323 M138L probably benign Het
Dnah6 A T 6: 73,129,540 M1738K probably damaging Het
Eif4enif1 T A 11: 3,215,686 S88T probably benign Het
Eno3 T C 11: 70,658,666 probably null Het
Erbb3 C A 10: 128,571,204 S1029I probably damaging Het
Erbin C A 13: 103,841,178 V624L probably damaging Het
Fam170b C T 14: 32,835,402 Q65* probably null Het
Fam208b T C 13: 3,569,507 I2241M possibly damaging Het
Gin1 T A 1: 97,786,055 L360* probably null Het
Gldc A T 19: 30,143,453 D359E probably damaging Het
Gpr107 A T 2: 31,167,051 T52S possibly damaging Het
Hip1r A G 5: 123,994,820 Y227C probably damaging Het
Hspa1l A G 17: 34,977,443 N153D probably damaging Het
Itga8 C A 2: 12,200,163 V488L probably damaging Het
Kcnk10 G A 12: 98,496,288 A134V probably benign Het
Kif18a T A 2: 109,298,403 C406S probably benign Het
Klhl28 A T 12: 64,951,819 S300R probably damaging Het
Kmt2e C T 5: 23,482,453 Q434* probably null Het
Lilrb4a A G 10: 51,496,185 T222A probably benign Het
Lipn G A 19: 34,080,710 R277Q probably damaging Het
Lrrc61 G A 6: 48,568,774 R177Q possibly damaging Het
Lrrc74a G A 12: 86,741,026 E144K probably damaging Het
Mal T C 2: 127,635,044 Y77C probably benign Het
Map1a T A 2: 121,302,655 C1079* probably null Het
Mbd5 T A 2: 49,256,218 S147T possibly damaging Het
Nsd2 T A 5: 33,861,149 M509K probably benign Het
Olfr1342 C T 4: 118,689,948 R168H probably benign Het
Olfr262 C T 19: 12,240,831 V277I probably benign Het
Olfr414 T C 1: 174,431,097 V223A probably benign Het
Olfr51 T C 11: 51,007,637 F222L probably benign Het
Rcor2 C T 19: 7,270,181 L45F probably damaging Het
Rpl12 T A 2: 32,963,525 D107E probably benign Het
Rpl7l1 A T 17: 46,778,191 F205I probably damaging Het
Samd4b C T 7: 28,414,010 G177R probably damaging Het
Sema4a A T 3: 88,454,766 F18I possibly damaging Het
Slc37a1 A T 17: 31,338,074 T405S probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Syt14 T C 1: 192,897,482 D781G probably damaging Het
Tprn T G 2: 25,264,409 D574E probably benign Het
Trim75 T A 8: 64,982,511 E429V probably damaging Het
Trit1 C T 4: 123,054,236 R450C possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Unc13c A G 9: 73,639,050 probably null Het
Usp49 C A 17: 47,673,410 L447I probably damaging Het
Vmn1r20 T C 6: 57,431,952 C88R probably benign Het
Zfp94 T A 7: 24,302,834 K394N probably damaging Het
Other mutations in Hmgxb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Hmgxb3 APN 18 61157739 missense probably benign 0.00
IGL01325:Hmgxb3 APN 18 61134006 missense probably damaging 1.00
IGL01364:Hmgxb3 APN 18 61146434 missense probably damaging 0.96
IGL02160:Hmgxb3 APN 18 61171236 missense probably damaging 1.00
IGL02271:Hmgxb3 APN 18 61132213 missense probably damaging 1.00
IGL02755:Hmgxb3 APN 18 61172188 missense probably damaging 1.00
R0309:Hmgxb3 UTSW 18 61155128 splice site probably benign
R0828:Hmgxb3 UTSW 18 61171354 missense probably damaging 1.00
R1276:Hmgxb3 UTSW 18 61165504 missense probably benign 0.04
R1429:Hmgxb3 UTSW 18 61150433 missense probably damaging 0.98
R1491:Hmgxb3 UTSW 18 61133908 missense probably benign 0.04
R1886:Hmgxb3 UTSW 18 61137401 critical splice donor site probably null
R1887:Hmgxb3 UTSW 18 61137401 critical splice donor site probably null
R2070:Hmgxb3 UTSW 18 61171359 missense probably damaging 1.00
R2084:Hmgxb3 UTSW 18 61155023 splice site probably benign
R2110:Hmgxb3 UTSW 18 61155386 missense possibly damaging 0.54
R2112:Hmgxb3 UTSW 18 61155386 missense possibly damaging 0.54
R2149:Hmgxb3 UTSW 18 61157674 missense probably benign 0.08
R2342:Hmgxb3 UTSW 18 61162991 missense possibly damaging 0.89
R2436:Hmgxb3 UTSW 18 61147494 missense probably benign
R2898:Hmgxb3 UTSW 18 61155296 missense probably benign 0.00
R2975:Hmgxb3 UTSW 18 61162966 nonsense probably null
R3110:Hmgxb3 UTSW 18 61147382 missense probably damaging 1.00
R3111:Hmgxb3 UTSW 18 61147382 missense probably damaging 1.00
R3112:Hmgxb3 UTSW 18 61147382 missense probably damaging 1.00
R4327:Hmgxb3 UTSW 18 61167539 missense probably benign 0.11
R4710:Hmgxb3 UTSW 18 61137475 missense probably damaging 1.00
R4750:Hmgxb3 UTSW 18 61167496 missense probably benign
R4876:Hmgxb3 UTSW 18 61146534 missense possibly damaging 0.94
R5177:Hmgxb3 UTSW 18 61172194 missense probably damaging 1.00
R5490:Hmgxb3 UTSW 18 61162977 missense probably damaging 0.99
R5601:Hmgxb3 UTSW 18 61137622 missense probably damaging 1.00
R5718:Hmgxb3 UTSW 18 61140837 missense probably benign 0.05
R6011:Hmgxb3 UTSW 18 61163024 missense probably damaging 0.97
R6034:Hmgxb3 UTSW 18 61132522 missense probably damaging 1.00
R6034:Hmgxb3 UTSW 18 61132522 missense probably damaging 1.00
R6092:Hmgxb3 UTSW 18 61137600 missense possibly damaging 0.56
R6142:Hmgxb3 UTSW 18 61136237 missense probably benign 0.00
R6419:Hmgxb3 UTSW 18 61152224 missense possibly damaging 0.71
R6675:Hmgxb3 UTSW 18 61137576 missense possibly damaging 0.86
R7130:Hmgxb3 UTSW 18 61132378 missense probably benign
R7431:Hmgxb3 UTSW 18 61147445 missense probably damaging 1.00
R8265:Hmgxb3 UTSW 18 61167338 missense possibly damaging 0.77
R8559:Hmgxb3 UTSW 18 61155419 missense probably benign 0.19
R8674:Hmgxb3 UTSW 18 61136231 missense probably benign 0.37
R8711:Hmgxb3 UTSW 18 61157649 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCACAAATGGCAATGACTCTCCAGG -3'
(R):5'- AATGGCTGCTGTGAACGTGGAC -3'

Sequencing Primer
(F):5'- AATGACTCTCCAGGTTGCACTG -3'
(R):5'- tcagattcaaatgctaactccac -3'
Posted On2014-05-09