Incidental Mutation 'R1676:Nsun6'
ID188043
Institutional Source Beutler Lab
Gene Symbol Nsun6
Ensembl Gene ENSMUSG00000026707
Gene NameNOL1/NOP2/Sun domain family member 6
Synonyms4933414E04Rik, 4933403D21Rik, NOPD1
MMRRC Submission 039712-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R1676 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location14995131-15055069 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 15047213 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 56 (R56*)
Ref Sequence ENSEMBL: ENSMUSP00000141924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017562] [ENSMUST00000028034] [ENSMUST00000076435] [ENSMUST00000114713] [ENSMUST00000114715] [ENSMUST00000195749]
Predicted Effect probably benign
Transcript: ENSMUST00000017562
SMART Domains Protein: ENSMUSP00000017562
Gene: ENSMUSG00000017418

DomainStartEndE-ValueType
ARF 4 171 4.8e-58 SMART
Predicted Effect probably null
Transcript: ENSMUST00000028034
AA Change: R56*
SMART Domains Protein: ENSMUSP00000028034
Gene: ENSMUSG00000026707
AA Change: R56*

DomainStartEndE-ValueType
PUA 112 203 1.96e-4 SMART
Pfam:FtsJ 216 397 1.4e-8 PFAM
Pfam:Methyltransf_31 232 423 1.3e-9 PFAM
Pfam:Methyltransf_18 234 373 1.4e-8 PFAM
Pfam:Methyltransf_26 235 374 2.9e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000076435
AA Change: R56*
SMART Domains Protein: ENSMUSP00000075766
Gene: ENSMUSG00000026707
AA Change: R56*

DomainStartEndE-ValueType
PUA 112 203 1.96e-4 SMART
Pfam:FtsJ 224 392 4.7e-9 PFAM
Pfam:Nol1_Nop2_Fmu 227 464 4.7e-48 PFAM
Pfam:Methyltransf_31 232 423 8.8e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000114713
AA Change: R56*
Predicted Effect probably null
Transcript: ENSMUST00000114715
AA Change: R5*
SMART Domains Protein: ENSMUSP00000110363
Gene: ENSMUSG00000026707
AA Change: R5*

DomainStartEndE-ValueType
PUA 61 152 1.96e-4 SMART
Pfam:FtsJ 165 346 4.5e-9 PFAM
Pfam:Methyltransf_31 181 372 2.3e-10 PFAM
Pfam:Methyltransf_18 183 322 2.8e-9 PFAM
Pfam:Methyltransf_26 184 323 5.1e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191911
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192769
Predicted Effect probably null
Transcript: ENSMUST00000195749
AA Change: R56*
SMART Domains Protein: ENSMUSP00000141924
Gene: ENSMUSG00000026707
AA Change: R56*

DomainStartEndE-ValueType
PUA 112 203 1.96e-4 SMART
Pfam:FtsJ 216 397 1.4e-8 PFAM
Pfam:Methyltransf_31 232 423 1.3e-9 PFAM
Pfam:Methyltransf_18 234 373 1.4e-8 PFAM
Pfam:Methyltransf_26 235 374 2.9e-9 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik G T 11: 58,880,993 A434S possibly damaging Het
Abhd8 T A 8: 71,461,873 D37V probably damaging Het
Acvr2a G A 2: 48,873,083 S97N probably benign Het
Ampd3 T A 7: 110,795,733 H296Q probably damaging Het
Arid4a G A 12: 71,075,338 S509N probably benign Het
Cap2 T G 13: 46,637,859 H167Q probably damaging Het
Car8 A G 4: 8,185,616 L180S probably damaging Het
Casp8 T A 1: 58,844,416 I314N probably damaging Het
Cavin2 T A 1: 51,301,171 S336T probably benign Het
Cdc14b A T 13: 64,225,602 I119N possibly damaging Het
Cemip T A 7: 83,964,038 I651F possibly damaging Het
Cfap57 T A 4: 118,595,940 D522V probably damaging Het
Clrn3 A T 7: 135,518,578 V93D probably damaging Het
Cyp4f39 A G 17: 32,482,202 D222G probably benign Het
D5Ertd579e A G 5: 36,616,109 V314A probably benign Het
Dchs1 C T 7: 105,754,921 V2805I probably benign Het
Dsp A T 13: 38,193,374 K1712* probably null Het
Emilin2 T C 17: 71,274,090 D547G probably benign Het
Erbb3 T C 10: 128,583,248 H248R probably benign Het
Erich3 A G 3: 154,762,623 probably benign Het
Fam213b C T 4: 154,897,063 V186I probably benign Het
Fbn1 T C 2: 125,309,781 T2518A probably damaging Het
Fzd2 G A 11: 102,605,881 V384M probably damaging Het
Gm14085 T C 2: 122,521,859 S366P probably damaging Het
Gpc5 T A 14: 115,370,098 S371T probably damaging Het
Hbb-bh2 T C 7: 103,839,155 K145R probably null Het
Hectd1 G T 12: 51,744,788 P2558Q probably damaging Het
Hgsnat C T 8: 25,954,605 probably null Het
Hirip3 T C 7: 126,863,475 probably null Het
Ispd T C 12: 36,476,721 C170R probably benign Het
Itpkc T C 7: 27,208,281 D666G probably damaging Het
Jmjd1c T A 10: 67,224,809 D693E probably benign Het
Katnbl1 T C 2: 112,406,109 L60P probably damaging Het
Kcna1 T A 6: 126,642,682 E225V probably damaging Het
Kcnj6 T A 16: 94,832,584 M223L probably damaging Het
Kcnk7 G T 19: 5,706,978 V332F probably benign Het
Kmt5a GAA GA 5: 124,459,885 probably null Het
Mdga2 C A 12: 66,568,773 G618* probably null Het
Mdga2 C A 12: 66,568,772 G618V probably damaging Het
Morc2b T C 17: 33,135,981 E939G possibly damaging Het
Mstn T A 1: 53,062,065 D100E probably benign Het
Mthfd1l G A 10: 4,083,877 probably null Het
Muc20 T A 16: 32,794,279 T243S probably damaging Het
Myo1d A T 11: 80,684,421 N156K probably damaging Het
Myo7a A G 7: 98,099,472 probably null Het
Naa35 A T 13: 59,612,676 Q274L probably damaging Het
Ncam1 G A 9: 49,557,172 T329I probably damaging Het
Nisch T C 14: 31,180,902 probably benign Het
Nlrp1b A T 11: 71,182,811 W69R probably benign Het
Nrap T A 19: 56,335,255 H1294L probably damaging Het
Nudt1 A G 5: 140,334,623 probably null Het
Nxph4 T G 10: 127,526,208 K271N probably damaging Het
Olfr1196 T G 2: 88,701,317 H4P probably benign Het
Olfr243 T C 7: 103,717,112 W173R probably benign Het
Olfr366 A T 2: 37,219,641 R51* probably null Het
Olfr78 T A 7: 102,742,398 I202F probably damaging Het
Otud6b T A 4: 14,825,617 N71I probably damaging Het
Parp8 T A 13: 116,877,528 D623V probably damaging Het
Pcdhb5 T C 18: 37,320,752 S62P probably benign Het
Ppp1r12b A G 1: 134,777,452 S833P probably damaging Het
Ppp1r1a T G 15: 103,533,488 D51A probably damaging Het
Prag1 C A 8: 36,102,898 P212T probably damaging Het
Ptdss1 A G 13: 66,933,637 T44A probably damaging Het
Rab14 T C 2: 35,186,723 H83R possibly damaging Het
Rapgef3 C T 15: 97,761,182 G101E probably benign Het
Rimbp3 T A 16: 17,211,113 D800E probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Selenbp1 A G 3: 94,944,543 D465G probably damaging Het
Slc29a1 T C 17: 45,589,010 D251G probably damaging Het
Slc6a11 G T 6: 114,247,666 V604F probably benign Het
Sltm T A 9: 70,573,647 D260E probably damaging Het
Spta1 G A 1: 174,179,839 V212M probably damaging Het
St6gal2 T C 17: 55,496,395 probably null Het
Tc2n A G 12: 101,688,992 S235P probably damaging Het
Tenm3 T A 8: 48,417,119 N213I possibly damaging Het
Ticam2 T C 18: 46,560,610 T137A probably damaging Het
Ttn TCCC TCCCC 2: 76,742,907 probably null Het
Tyk2 G A 9: 21,115,249 Q684* probably null Het
Ubqln1 A G 13: 58,179,391 F478S possibly damaging Het
Uckl1 G A 2: 181,574,918 T78I probably damaging Het
Uhmk1 A G 1: 170,200,012 V372A probably damaging Het
Unc5c G A 3: 141,757,837 V240I possibly damaging Het
Ush2a T C 1: 188,728,585 L2681P probably damaging Het
Vmn2r1 C T 3: 64,090,182 Q420* probably null Het
Vmn2r101 A T 17: 19,611,922 T727S probably benign Het
Vmn2r79 A G 7: 87,002,631 T413A probably benign Het
Vps13c T C 9: 67,926,962 V1637A probably benign Het
Xpc A G 6: 91,492,947 V765A possibly damaging Het
Zbtb18 T G 1: 177,447,347 probably null Het
Zfp712 A T 13: 67,052,336 D28E probably benign Het
Zfp735 A G 11: 73,711,475 N415S possibly damaging Het
Other mutations in Nsun6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Nsun6 APN 2 15048978 missense possibly damaging 0.69
IGL02347:Nsun6 APN 2 15030020 splice site probably benign
IGL03352:Nsun6 APN 2 14996346 nonsense probably null
R0371:Nsun6 UTSW 2 15030087 missense probably damaging 1.00
R0639:Nsun6 UTSW 2 14996336 missense probably benign
R0737:Nsun6 UTSW 2 14996474 missense probably damaging 1.00
R1076:Nsun6 UTSW 2 15009472 missense probably benign 0.01
R1842:Nsun6 UTSW 2 15009477 missense probably damaging 0.98
R1989:Nsun6 UTSW 2 15038184 missense probably benign
R2091:Nsun6 UTSW 2 15039731 critical splice donor site probably null
R2972:Nsun6 UTSW 2 15038072 critical splice donor site probably null
R3276:Nsun6 UTSW 2 15009404 splice site probably benign
R4386:Nsun6 UTSW 2 14996522 missense probably benign 0.05
R4761:Nsun6 UTSW 2 15030061 missense possibly damaging 0.88
R4782:Nsun6 UTSW 2 15036326 missense possibly damaging 0.88
R6701:Nsun6 UTSW 2 15036302 missense probably benign 0.00
R6890:Nsun6 UTSW 2 15048977 missense probably damaging 1.00
R7555:Nsun6 UTSW 2 14996339 missense possibly damaging 0.73
R7587:Nsun6 UTSW 2 15039825 missense probably benign
R7880:Nsun6 UTSW 2 14996379 missense probably damaging 0.99
R7888:Nsun6 UTSW 2 14996544 missense probably benign 0.01
R7963:Nsun6 UTSW 2 14996379 missense probably damaging 0.99
R7971:Nsun6 UTSW 2 14996544 missense probably benign 0.01
Z1177:Nsun6 UTSW 2 15039820 missense probably benign
Z1177:Nsun6 UTSW 2 15030103 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGCAGAGAATAGAAGTATGACTGCC -3'
(R):5'- GCCATCCCATTTGTAAAACAGTTTGGAA -3'

Sequencing Primer
(F):5'- ttcaattcccagggaccac -3'
(R):5'- TTTGTAAAACAGTTTGGAAAGGAAAG -3'
Posted On2014-05-09