Incidental Mutation 'R1676:Erich3'
ID188057
Institutional Source Beutler Lab
Gene Symbol Erich3
Ensembl Gene ENSMUSG00000078161
Gene Nameglutamate rich 3
Synonyms4922501L14Rik
MMRRC Submission 039712-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1676 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location154663859-154767790 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 154762623 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098496] [ENSMUST00000189969]
Predicted Effect unknown
Transcript: ENSMUST00000098496
AA Change: D904G
SMART Domains Protein: ENSMUSP00000096097
Gene: ENSMUSG00000078161
AA Change: D904G

DomainStartEndE-ValueType
internal_repeat_1 18 102 3.73e-10 PROSPERO
internal_repeat_1 155 240 3.73e-10 PROSPERO
low complexity region 501 514 N/A INTRINSIC
low complexity region 756 773 N/A INTRINSIC
low complexity region 792 809 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189969
SMART Domains Protein: ENSMUSP00000140929
Gene: ENSMUSG00000078161

DomainStartEndE-ValueType
low complexity region 31 48 N/A INTRINSIC
low complexity region 67 84 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik G T 11: 58,880,993 A434S possibly damaging Het
Abhd8 T A 8: 71,461,873 D37V probably damaging Het
Acvr2a G A 2: 48,873,083 S97N probably benign Het
Ampd3 T A 7: 110,795,733 H296Q probably damaging Het
Arid4a G A 12: 71,075,338 S509N probably benign Het
Cap2 T G 13: 46,637,859 H167Q probably damaging Het
Car8 A G 4: 8,185,616 L180S probably damaging Het
Casp8 T A 1: 58,844,416 I314N probably damaging Het
Cavin2 T A 1: 51,301,171 S336T probably benign Het
Cdc14b A T 13: 64,225,602 I119N possibly damaging Het
Cemip T A 7: 83,964,038 I651F possibly damaging Het
Cfap57 T A 4: 118,595,940 D522V probably damaging Het
Clrn3 A T 7: 135,518,578 V93D probably damaging Het
Cyp4f39 A G 17: 32,482,202 D222G probably benign Het
D5Ertd579e A G 5: 36,616,109 V314A probably benign Het
Dchs1 C T 7: 105,754,921 V2805I probably benign Het
Dsp A T 13: 38,193,374 K1712* probably null Het
Emilin2 T C 17: 71,274,090 D547G probably benign Het
Erbb3 T C 10: 128,583,248 H248R probably benign Het
Fam213b C T 4: 154,897,063 V186I probably benign Het
Fbn1 T C 2: 125,309,781 T2518A probably damaging Het
Fzd2 G A 11: 102,605,881 V384M probably damaging Het
Gm14085 T C 2: 122,521,859 S366P probably damaging Het
Gpc5 T A 14: 115,370,098 S371T probably damaging Het
Hbb-bh2 T C 7: 103,839,155 K145R probably null Het
Hectd1 G T 12: 51,744,788 P2558Q probably damaging Het
Hgsnat C T 8: 25,954,605 probably null Het
Hirip3 T C 7: 126,863,475 probably null Het
Ispd T C 12: 36,476,721 C170R probably benign Het
Itpkc T C 7: 27,208,281 D666G probably damaging Het
Jmjd1c T A 10: 67,224,809 D693E probably benign Het
Katnbl1 T C 2: 112,406,109 L60P probably damaging Het
Kcna1 T A 6: 126,642,682 E225V probably damaging Het
Kcnj6 T A 16: 94,832,584 M223L probably damaging Het
Kcnk7 G T 19: 5,706,978 V332F probably benign Het
Kmt5a GAA GA 5: 124,459,885 probably null Het
Mdga2 C A 12: 66,568,772 G618V probably damaging Het
Mdga2 C A 12: 66,568,773 G618* probably null Het
Morc2b T C 17: 33,135,981 E939G possibly damaging Het
Mstn T A 1: 53,062,065 D100E probably benign Het
Mthfd1l G A 10: 4,083,877 probably null Het
Muc20 T A 16: 32,794,279 T243S probably damaging Het
Myo1d A T 11: 80,684,421 N156K probably damaging Het
Myo7a A G 7: 98,099,472 probably null Het
Naa35 A T 13: 59,612,676 Q274L probably damaging Het
Ncam1 G A 9: 49,557,172 T329I probably damaging Het
Nisch T C 14: 31,180,902 probably benign Het
Nlrp1b A T 11: 71,182,811 W69R probably benign Het
Nrap T A 19: 56,335,255 H1294L probably damaging Het
Nsun6 T A 2: 15,047,213 R56* probably null Het
Nudt1 A G 5: 140,334,623 probably null Het
Nxph4 T G 10: 127,526,208 K271N probably damaging Het
Olfr1196 T G 2: 88,701,317 H4P probably benign Het
Olfr243 T C 7: 103,717,112 W173R probably benign Het
Olfr366 A T 2: 37,219,641 R51* probably null Het
Olfr78 T A 7: 102,742,398 I202F probably damaging Het
Otud6b T A 4: 14,825,617 N71I probably damaging Het
Parp8 T A 13: 116,877,528 D623V probably damaging Het
Pcdhb5 T C 18: 37,320,752 S62P probably benign Het
Ppp1r12b A G 1: 134,777,452 S833P probably damaging Het
Ppp1r1a T G 15: 103,533,488 D51A probably damaging Het
Prag1 C A 8: 36,102,898 P212T probably damaging Het
Ptdss1 A G 13: 66,933,637 T44A probably damaging Het
Rab14 T C 2: 35,186,723 H83R possibly damaging Het
Rapgef3 C T 15: 97,761,182 G101E probably benign Het
Rimbp3 T A 16: 17,211,113 D800E probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Selenbp1 A G 3: 94,944,543 D465G probably damaging Het
Slc29a1 T C 17: 45,589,010 D251G probably damaging Het
Slc6a11 G T 6: 114,247,666 V604F probably benign Het
Sltm T A 9: 70,573,647 D260E probably damaging Het
Spta1 G A 1: 174,179,839 V212M probably damaging Het
St6gal2 T C 17: 55,496,395 probably null Het
Tc2n A G 12: 101,688,992 S235P probably damaging Het
Tenm3 T A 8: 48,417,119 N213I possibly damaging Het
Ticam2 T C 18: 46,560,610 T137A probably damaging Het
Ttn TCCC TCCCC 2: 76,742,907 probably null Het
Tyk2 G A 9: 21,115,249 Q684* probably null Het
Ubqln1 A G 13: 58,179,391 F478S possibly damaging Het
Uckl1 G A 2: 181,574,918 T78I probably damaging Het
Uhmk1 A G 1: 170,200,012 V372A probably damaging Het
Unc5c G A 3: 141,757,837 V240I possibly damaging Het
Ush2a T C 1: 188,728,585 L2681P probably damaging Het
Vmn2r1 C T 3: 64,090,182 Q420* probably null Het
Vmn2r101 A T 17: 19,611,922 T727S probably benign Het
Vmn2r79 A G 7: 87,002,631 T413A probably benign Het
Vps13c T C 9: 67,926,962 V1637A probably benign Het
Xpc A G 6: 91,492,947 V765A possibly damaging Het
Zbtb18 T G 1: 177,447,347 probably null Het
Zfp712 A T 13: 67,052,336 D28E probably benign Het
Zfp735 A G 11: 73,711,475 N415S possibly damaging Het
Other mutations in Erich3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Erich3 APN 3 154748519 missense probably benign 0.44
IGL01141:Erich3 APN 3 154714016 missense probably benign 0.08
IGL01812:Erich3 APN 3 154713971 missense possibly damaging 0.70
IGL02126:Erich3 APN 3 154713962 missense possibly damaging 0.60
IGL03371:Erich3 APN 3 154727477 missense probably damaging 0.97
IGL03386:Erich3 APN 3 154739239 missense possibly damaging 0.80
FR4449:Erich3 UTSW 3 154763513 unclassified probably benign
R0942:Erich3 UTSW 3 154739151 missense probably benign 0.00
R1558:Erich3 UTSW 3 154714068 missense probably damaging 0.99
R1582:Erich3 UTSW 3 154764323 unclassified probably benign
R1674:Erich3 UTSW 3 154762623 unclassified probably benign
R1724:Erich3 UTSW 3 154762327 missense possibly damaging 0.89
R1757:Erich3 UTSW 3 154695765 missense probably damaging 0.98
R1771:Erich3 UTSW 3 154748472 missense possibly damaging 0.82
R2384:Erich3 UTSW 3 154764651 missense possibly damaging 0.92
R2410:Erich3 UTSW 3 154733603 missense probably damaging 0.98
R2507:Erich3 UTSW 3 154698659 missense probably null 1.00
R3621:Erich3 UTSW 3 154748732 missense possibly damaging 0.83
R3755:Erich3 UTSW 3 154764321 unclassified probably benign
R3756:Erich3 UTSW 3 154764321 unclassified probably benign
R3756:Erich3 UTSW 3 154764578 missense possibly damaging 0.66
R3832:Erich3 UTSW 3 154762361 missense probably damaging 0.97
R4020:Erich3 UTSW 3 154714049 missense probably damaging 0.97
R4601:Erich3 UTSW 3 154764738 missense unknown
R4628:Erich3 UTSW 3 154763687 missense probably damaging 1.00
R4841:Erich3 UTSW 3 154704843 missense possibly damaging 0.87
R4842:Erich3 UTSW 3 154704843 missense possibly damaging 0.87
R4863:Erich3 UTSW 3 154764804 missense unknown
R4989:Erich3 UTSW 3 154748388 missense possibly damaging 0.85
R5310:Erich3 UTSW 3 154763580 missense probably damaging 1.00
R5596:Erich3 UTSW 3 154727396 missense probably damaging 0.99
R5695:Erich3 UTSW 3 154733573 missense probably damaging 1.00
R5742:Erich3 UTSW 3 154733323 missense probably damaging 1.00
R5859:Erich3 UTSW 3 154762497 missense possibly damaging 0.90
R5916:Erich3 UTSW 3 154695823 missense probably damaging 1.00
R6172:Erich3 UTSW 3 154764341 missense possibly damaging 0.66
R6321:Erich3 UTSW 3 154727502 missense probably damaging 1.00
R6438:Erich3 UTSW 3 154695753 missense probably damaging 1.00
R6520:Erich3 UTSW 3 154763465 missense probably damaging 0.98
R6679:Erich3 UTSW 3 154762429 missense possibly damaging 0.81
R6697:Erich3 UTSW 3 154764270 unclassified probably benign
R6800:Erich3 UTSW 3 154727392 critical splice acceptor site probably null
R6823:Erich3 UTSW 3 154727437 missense probably damaging 1.00
R6855:Erich3 UTSW 3 154762649 nonsense probably null
R6989:Erich3 UTSW 3 154763677 unclassified probably benign
R7400:Erich3 UTSW 3 154762577 missense
R7421:Erich3 UTSW 3 154733561 missense probably damaging 1.00
R7520:Erich3 UTSW 3 154763126 missense unknown
R7553:Erich3 UTSW 3 154733500 missense probably benign 0.01
R7751:Erich3 UTSW 3 154763789 missense unknown
R7768:Erich3 UTSW 3 154748331 missense probably benign 0.00
R7955:Erich3 UTSW 3 154739314 nonsense probably null
R8001:Erich3 UTSW 3 154713916 missense probably benign 0.21
R8101:Erich3 UTSW 3 154733513 missense probably damaging 0.99
R8108:Erich3 UTSW 3 154720115 missense possibly damaging 0.91
R8162:Erich3 UTSW 3 154764573 missense unknown
R8310:Erich3 UTSW 3 154704949 missense
Z1176:Erich3 UTSW 3 154698701 missense
Z1176:Erich3 UTSW 3 154762430 missense
Predicted Primers PCR Primer
(F):5'- ACTATCCCCAGGATGCTGACATGG -3'
(R):5'- AACACAGAGCCTTCTGCTGCTACC -3'

Sequencing Primer
(F):5'- ATGCTGACATGGATGTGGGAC -3'
(R):5'- AGCTATGTTCAGATAGCACTCC -3'
Posted On2014-05-09