Incidental Mutation 'R1676:Cfap57'
ID 188061
Institutional Source Beutler Lab
Gene Symbol Cfap57
Ensembl Gene ENSMUSG00000028730
Gene Name cilia and flagella associated protein 57
Synonyms Wdr65, 1110020C03Rik, C130004B06Rik, LOC384050
MMRRC Submission 039712-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1676 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 118554551-118620777 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 118595940 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 522 (D522V)
Ref Sequence ENSEMBL: ENSMUSP00000080592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071972] [ENSMUST00000081921]
AlphaFold Q9D180
Predicted Effect probably damaging
Transcript: ENSMUST00000071972
AA Change: D522V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000071863
Gene: ENSMUSG00000028730
AA Change: D522V

DomainStartEndE-ValueType
Blast:WD40 44 88 3e-12 BLAST
Blast:WD40 95 137 1e-9 BLAST
WD40 140 181 1.77e2 SMART
internal_repeat_1 182 237 7.23e-5 PROSPERO
WD40 329 365 1.27e2 SMART
WD40 376 416 3.4e-2 SMART
WD40 418 456 1.59e1 SMART
Blast:WD40 461 497 4e-18 BLAST
WD40 500 539 9.67e-7 SMART
WD40 544 581 3.96e1 SMART
Blast:WD40 582 621 8e-16 BLAST
WD40 626 665 3.21e-1 SMART
coiled coil region 690 1056 N/A INTRINSIC
coiled coil region 1094 1166 N/A INTRINSIC
coiled coil region 1197 1222 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000081921
AA Change: D522V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000080592
Gene: ENSMUSG00000028730
AA Change: D522V

DomainStartEndE-ValueType
Blast:WD40 44 88 3e-12 BLAST
Blast:WD40 95 137 1e-9 BLAST
WD40 140 181 1.77e2 SMART
internal_repeat_1 182 237 7.23e-5 PROSPERO
WD40 329 365 1.27e2 SMART
WD40 376 416 3.4e-2 SMART
WD40 418 456 1.59e1 SMART
Blast:WD40 461 497 4e-18 BLAST
WD40 500 539 9.67e-7 SMART
WD40 544 581 3.96e1 SMART
Blast:WD40 582 621 8e-16 BLAST
WD40 626 665 3.21e-1 SMART
coiled coil region 690 1056 N/A INTRINSIC
coiled coil region 1094 1166 N/A INTRINSIC
coiled coil region 1197 1222 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein encoded by this gene belongs to the WD repeat-containing family of proteins, which function in the formation of protein-protein complexes in a variety of biological pathways. This family member is thought to function in craniofacial development, possibly in the fusion of lip and palate. A missense mutation in this gene is associated with Van der Woude syndrome 2. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik G T 11: 58,880,993 A434S possibly damaging Het
Abhd8 T A 8: 71,461,873 D37V probably damaging Het
Acvr2a G A 2: 48,873,083 S97N probably benign Het
Ampd3 T A 7: 110,795,733 H296Q probably damaging Het
Arid4a G A 12: 71,075,338 S509N probably benign Het
Cap2 T G 13: 46,637,859 H167Q probably damaging Het
Car8 A G 4: 8,185,616 L180S probably damaging Het
Casp8 T A 1: 58,844,416 I314N probably damaging Het
Cavin2 T A 1: 51,301,171 S336T probably benign Het
Cdc14b A T 13: 64,225,602 I119N possibly damaging Het
Cemip T A 7: 83,964,038 I651F possibly damaging Het
Clrn3 A T 7: 135,518,578 V93D probably damaging Het
Cyp4f39 A G 17: 32,482,202 D222G probably benign Het
D5Ertd579e A G 5: 36,616,109 V314A probably benign Het
Dchs1 C T 7: 105,754,921 V2805I probably benign Het
Dsp A T 13: 38,193,374 K1712* probably null Het
Emilin2 T C 17: 71,274,090 D547G probably benign Het
Erbb3 T C 10: 128,583,248 H248R probably benign Het
Erich3 A G 3: 154,762,623 probably benign Het
Fam213b C T 4: 154,897,063 V186I probably benign Het
Fbn1 T C 2: 125,309,781 T2518A probably damaging Het
Fzd2 G A 11: 102,605,881 V384M probably damaging Het
Gm14085 T C 2: 122,521,859 S366P probably damaging Het
Gpc5 T A 14: 115,370,098 S371T probably damaging Het
Hbb-bh2 T C 7: 103,839,155 K145R probably null Het
Hectd1 G T 12: 51,744,788 P2558Q probably damaging Het
Hgsnat C T 8: 25,954,605 probably null Het
Hirip3 T C 7: 126,863,475 probably null Het
Ispd T C 12: 36,476,721 C170R probably benign Het
Itpkc T C 7: 27,208,281 D666G probably damaging Het
Jmjd1c T A 10: 67,224,809 D693E probably benign Het
Katnbl1 T C 2: 112,406,109 L60P probably damaging Het
Kcna1 T A 6: 126,642,682 E225V probably damaging Het
Kcnj6 T A 16: 94,832,584 M223L probably damaging Het
Kcnk7 G T 19: 5,706,978 V332F probably benign Het
Kmt5a GAA GA 5: 124,459,885 probably null Het
Mdga2 C A 12: 66,568,772 G618V probably damaging Het
Mdga2 C A 12: 66,568,773 G618* probably null Het
Morc2b T C 17: 33,135,981 E939G possibly damaging Het
Mstn T A 1: 53,062,065 D100E probably benign Het
Mthfd1l G A 10: 4,083,877 probably null Het
Muc20 T A 16: 32,794,279 T243S probably damaging Het
Myo1d A T 11: 80,684,421 N156K probably damaging Het
Myo7a A G 7: 98,099,472 probably null Het
Naa35 A T 13: 59,612,676 Q274L probably damaging Het
Ncam1 G A 9: 49,557,172 T329I probably damaging Het
Nisch T C 14: 31,180,902 probably benign Het
Nlrp1b A T 11: 71,182,811 W69R probably benign Het
Nrap T A 19: 56,335,255 H1294L probably damaging Het
Nsun6 T A 2: 15,047,213 R56* probably null Het
Nudt1 A G 5: 140,334,623 probably null Het
Nxph4 T G 10: 127,526,208 K271N probably damaging Het
Olfr1196 T G 2: 88,701,317 H4P probably benign Het
Olfr243 T C 7: 103,717,112 W173R probably benign Het
Olfr366 A T 2: 37,219,641 R51* probably null Het
Olfr78 T A 7: 102,742,398 I202F probably damaging Het
Otud6b T A 4: 14,825,617 N71I probably damaging Het
Parp8 T A 13: 116,877,528 D623V probably damaging Het
Pcdhb5 T C 18: 37,320,752 S62P probably benign Het
Ppp1r12b A G 1: 134,777,452 S833P probably damaging Het
Ppp1r1a T G 15: 103,533,488 D51A probably damaging Het
Prag1 C A 8: 36,102,898 P212T probably damaging Het
Ptdss1 A G 13: 66,933,637 T44A probably damaging Het
Rab14 T C 2: 35,186,723 H83R possibly damaging Het
Rapgef3 C T 15: 97,761,182 G101E probably benign Het
Rimbp3 T A 16: 17,211,113 D800E probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Selenbp1 A G 3: 94,944,543 D465G probably damaging Het
Slc29a1 T C 17: 45,589,010 D251G probably damaging Het
Slc6a11 G T 6: 114,247,666 V604F probably benign Het
Sltm T A 9: 70,573,647 D260E probably damaging Het
Spta1 G A 1: 174,179,839 V212M probably damaging Het
St6gal2 T C 17: 55,496,395 probably null Het
Tc2n A G 12: 101,688,992 S235P probably damaging Het
Tenm3 T A 8: 48,417,119 N213I possibly damaging Het
Ticam2 T C 18: 46,560,610 T137A probably damaging Het
Ttn TCCC TCCCC 2: 76,742,907 probably null Het
Tyk2 G A 9: 21,115,249 Q684* probably null Het
Ubqln1 A G 13: 58,179,391 F478S possibly damaging Het
Uckl1 G A 2: 181,574,918 T78I probably damaging Het
Uhmk1 A G 1: 170,200,012 V372A probably damaging Het
Unc5c G A 3: 141,757,837 V240I possibly damaging Het
Ush2a T C 1: 188,728,585 L2681P probably damaging Het
Vmn2r1 C T 3: 64,090,182 Q420* probably null Het
Vmn2r101 A T 17: 19,611,922 T727S probably benign Het
Vmn2r79 A G 7: 87,002,631 T413A probably benign Het
Vps13c T C 9: 67,926,962 V1637A probably benign Het
Xpc A G 6: 91,492,947 V765A possibly damaging Het
Zbtb18 T G 1: 177,447,347 probably null Het
Zfp712 A T 13: 67,052,336 D28E probably benign Het
Zfp735 A G 11: 73,711,475 N415S possibly damaging Het
Other mutations in Cfap57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Cfap57 APN 4 118581001 missense probably benign 0.01
IGL00508:Cfap57 APN 4 118581170 splice site probably null
IGL00857:Cfap57 APN 4 118612923 critical splice donor site probably null
IGL01147:Cfap57 APN 4 118589001 missense probably damaging 0.97
IGL01396:Cfap57 APN 4 118610595 missense probably damaging 1.00
IGL01420:Cfap57 APN 4 118612940 missense probably benign 0.21
IGL01615:Cfap57 APN 4 118600796 missense probably damaging 1.00
IGL02154:Cfap57 APN 4 118613017 missense probably damaging 1.00
IGL02161:Cfap57 APN 4 118579372 missense possibly damaging 0.75
IGL02481:Cfap57 APN 4 118581105 missense probably damaging 1.00
IGL02483:Cfap57 APN 4 118581105 missense probably damaging 1.00
IGL02503:Cfap57 APN 4 118569348 critical splice donor site probably null
IGL02800:Cfap57 APN 4 118614750 missense probably damaging 1.00
IGL03083:Cfap57 APN 4 118584739 missense probably damaging 0.96
IGL03146:Cfap57 APN 4 118599019 missense probably damaging 1.00
IGL03246:Cfap57 APN 4 118576645 missense probably benign 0.29
IGL03376:Cfap57 APN 4 118584720 missense probably damaging 0.96
G1Funyon:Cfap57 UTSW 4 118593074 missense possibly damaging 0.94
R0144:Cfap57 UTSW 4 118584705 missense probably damaging 1.00
R0184:Cfap57 UTSW 4 118599012 missense probably damaging 1.00
R0415:Cfap57 UTSW 4 118569431 missense possibly damaging 0.89
R0515:Cfap57 UTSW 4 118620402 missense probably damaging 1.00
R0690:Cfap57 UTSW 4 118569727 splice site probably benign
R0730:Cfap57 UTSW 4 118612920 splice site probably null
R0737:Cfap57 UTSW 4 118581102 missense possibly damaging 0.81
R0854:Cfap57 UTSW 4 118561872 missense probably benign 0.04
R0880:Cfap57 UTSW 4 118581838 nonsense probably null
R1085:Cfap57 UTSW 4 118595779 missense probably benign 0.20
R1119:Cfap57 UTSW 4 118606676 nonsense probably null
R1217:Cfap57 UTSW 4 118606652 missense possibly damaging 0.67
R1294:Cfap57 UTSW 4 118606534 critical splice donor site probably null
R1487:Cfap57 UTSW 4 118614781 missense probably benign 0.01
R1688:Cfap57 UTSW 4 118569646 missense probably null 0.20
R1709:Cfap57 UTSW 4 118571704 missense probably benign 0.00
R1719:Cfap57 UTSW 4 118606631 missense probably benign 0.04
R1782:Cfap57 UTSW 4 118614975 missense probably damaging 0.98
R1791:Cfap57 UTSW 4 118571724 missense possibly damaging 0.66
R1850:Cfap57 UTSW 4 118599894 missense probably damaging 1.00
R1866:Cfap57 UTSW 4 118599927 missense possibly damaging 0.49
R1912:Cfap57 UTSW 4 118615010 missense probably damaging 0.96
R1978:Cfap57 UTSW 4 118593132 missense probably benign 0.03
R2177:Cfap57 UTSW 4 118606688 missense probably benign 0.00
R2322:Cfap57 UTSW 4 118610725 missense probably benign
R3905:Cfap57 UTSW 4 118595839 missense probably damaging 1.00
R4013:Cfap57 UTSW 4 118593143 missense probably benign 0.01
R4079:Cfap57 UTSW 4 118598997 missense probably benign 0.34
R4962:Cfap57 UTSW 4 118613065 missense probably benign 0.21
R4970:Cfap57 UTSW 4 118620371 missense probably damaging 0.99
R4974:Cfap57 UTSW 4 118593054 missense probably damaging 1.00
R4999:Cfap57 UTSW 4 118595848 missense probably benign 0.01
R5482:Cfap57 UTSW 4 118569641 missense probably benign
R5522:Cfap57 UTSW 4 118595888 missense probably benign 0.41
R5626:Cfap57 UTSW 4 118614783 missense probably damaging 1.00
R5685:Cfap57 UTSW 4 118569459 missense probably benign
R5712:Cfap57 UTSW 4 118614795 missense probably damaging 1.00
R5961:Cfap57 UTSW 4 118571745 missense probably benign 0.00
R6244:Cfap57 UTSW 4 118579410 missense probably damaging 0.99
R6268:Cfap57 UTSW 4 118569451 nonsense probably null
R6271:Cfap57 UTSW 4 118595759 missense probably benign 0.13
R6330:Cfap57 UTSW 4 118569396 missense probably benign
R6439:Cfap57 UTSW 4 118588975 critical splice donor site probably null
R6639:Cfap57 UTSW 4 118554712 missense probably benign 0.13
R6722:Cfap57 UTSW 4 118584717 missense probably damaging 1.00
R7033:Cfap57 UTSW 4 118613126 missense possibly damaging 0.67
R7143:Cfap57 UTSW 4 118620709 unclassified probably benign
R7162:Cfap57 UTSW 4 118614931 missense probably benign
R7174:Cfap57 UTSW 4 118589067 missense probably benign 0.35
R7210:Cfap57 UTSW 4 118576703 nonsense probably null
R7242:Cfap57 UTSW 4 118593096 missense possibly damaging 0.50
R7244:Cfap57 UTSW 4 118554800 nonsense probably null
R7359:Cfap57 UTSW 4 118598965 missense probably benign 0.01
R7373:Cfap57 UTSW 4 118614931 missense probably benign
R7394:Cfap57 UTSW 4 118593137 missense probably benign 0.00
R7401:Cfap57 UTSW 4 118614931 missense probably benign
R7412:Cfap57 UTSW 4 118614931 missense probably benign
R7414:Cfap57 UTSW 4 118614931 missense probably benign
R7452:Cfap57 UTSW 4 118595784 missense probably damaging 1.00
R7457:Cfap57 UTSW 4 118589001 missense probably damaging 0.97
R7559:Cfap57 UTSW 4 118614931 missense probably benign
R7642:Cfap57 UTSW 4 118614931 missense probably benign
R7741:Cfap57 UTSW 4 118614931 missense probably benign
R7744:Cfap57 UTSW 4 118614931 missense probably benign
R7745:Cfap57 UTSW 4 118614931 missense probably benign
R7842:Cfap57 UTSW 4 118554755 nonsense probably null
R7936:Cfap57 UTSW 4 118614931 missense probably benign
R7940:Cfap57 UTSW 4 118614931 missense probably benign
R7942:Cfap57 UTSW 4 118614931 missense probably benign
R8074:Cfap57 UTSW 4 118569625 missense possibly damaging 0.66
R8301:Cfap57 UTSW 4 118593074 missense possibly damaging 0.94
R8411:Cfap57 UTSW 4 118614931 missense probably benign
R8447:Cfap57 UTSW 4 118614931 missense probably benign
R8491:Cfap57 UTSW 4 118614931 missense probably benign
R8524:Cfap57 UTSW 4 118614931 missense probably benign
R8670:Cfap57 UTSW 4 118614925 missense possibly damaging 0.91
R8707:Cfap57 UTSW 4 118593006 missense probably benign 0.04
R8790:Cfap57 UTSW 4 118581914 missense possibly damaging 0.59
R8941:Cfap57 UTSW 4 118569602 missense probably damaging 0.99
R9139:Cfap57 UTSW 4 118554851 missense probably benign 0.02
R9212:Cfap57 UTSW 4 118579452 missense possibly damaging 0.95
X0022:Cfap57 UTSW 4 118614745 missense probably benign
Z1088:Cfap57 UTSW 4 118581882 missense probably benign 0.22
Z1177:Cfap57 UTSW 4 118598956 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTGGCATGACACAGTAGAGAACCC -3'
(R):5'- TGTATTAGAGCCCCTGAGTTTGTCTCC -3'

Sequencing Primer
(F):5'- CTTCTGTAGCACTGAGGAGC -3'
(R):5'- CCTCCCCAAGTTGGTGTG -3'
Posted On 2014-05-09