Mutagenetix > Incidental Mutations

Incidental Mutation 'R1676:Cfap57'

188061

Institutional Source

Beutler Lab

Gene Symbol

Cfap57

Ensembl Gene

ENSMUSG00000028730

Gene Name

cilia and flagella associated protein 57

Synonyms

Wdr65, 1110020C03Rik, C130004B06Rik, LOC384050

MMRRC Submission

039712-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1676 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

118554551-118620777 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 118595940 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 522 (D522V)

Ref Sequence

ENSEMBL: ENSMUSP00000080592 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071972] [ENSMUST00000081921]

AlphaFold

Q9D180

Predicted Effect

probably damaging
Transcript: ENSMUST00000071972
AA Change: D522V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000071863
Gene: ENSMUSG00000028730
AA Change: D522V

Domain	Start	End	E-Value	Type
Blast:WD40	44	88	3e-12	BLAST
Blast:WD40	95	137	1e-9	BLAST
WD40	140	181	1.77e2	SMART
internal_repeat_1	182	237	7.23e-5	PROSPERO
WD40	329	365	1.27e2	SMART
WD40	376	416	3.4e-2	SMART
WD40	418	456	1.59e1	SMART
Blast:WD40	461	497	4e-18	BLAST
WD40	500	539	9.67e-7	SMART
WD40	544	581	3.96e1	SMART
Blast:WD40	582	621	8e-16	BLAST
WD40	626	665	3.21e-1	SMART
coiled coil region	690	1056	N/A	INTRINSIC
coiled coil region	1094	1166	N/A	INTRINSIC
coiled coil region	1197	1222	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000081921
AA Change: D522V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000080592
Gene: ENSMUSG00000028730
AA Change: D522V

Domain	Start	End	E-Value	Type
Blast:WD40	44	88	3e-12	BLAST
Blast:WD40	95	137	1e-9	BLAST
WD40	140	181	1.77e2	SMART
internal_repeat_1	182	237	7.23e-5	PROSPERO
WD40	329	365	1.27e2	SMART
WD40	376	416	3.4e-2	SMART
WD40	418	456	1.59e1	SMART
Blast:WD40	461	497	4e-18	BLAST
WD40	500	539	9.67e-7	SMART
WD40	544	581	3.96e1	SMART
Blast:WD40	582	621	8e-16	BLAST
WD40	626	665	3.21e-1	SMART
coiled coil region	690	1056	N/A	INTRINSIC
coiled coil region	1094	1166	N/A	INTRINSIC
coiled coil region	1197	1222	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein encoded by this gene belongs to the WD repeat-containing family of proteins, which function in the formation of protein-protein complexes in a variety of biological pathways. This family member is thought to function in craniofacial development, possibly in the fusion of lip and palate. A missense mutation in this gene is associated with Van der Woude syndrome 2. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810021J22Rik	G	T	11: 58,880,993	A434S	possibly damaging	Het
Abhd8	T	A	8: 71,461,873	D37V	probably damaging	Het
Acvr2a	G	A	2: 48,873,083	S97N	probably benign	Het
Ampd3	T	A	7: 110,795,733	H296Q	probably damaging	Het
Arid4a	G	A	12: 71,075,338	S509N	probably benign	Het
Cap2	T	G	13: 46,637,859	H167Q	probably damaging	Het
Car8	A	G	4: 8,185,616	L180S	probably damaging	Het
Casp8	T	A	1: 58,844,416	I314N	probably damaging	Het
Cavin2	T	A	1: 51,301,171	S336T	probably benign	Het
Cdc14b	A	T	13: 64,225,602	I119N	possibly damaging	Het
Cemip	T	A	7: 83,964,038	I651F	possibly damaging	Het
Clrn3	A	T	7: 135,518,578	V93D	probably damaging	Het
Cyp4f39	A	G	17: 32,482,202	D222G	probably benign	Het
D5Ertd579e	A	G	5: 36,616,109	V314A	probably benign	Het
Dchs1	C	T	7: 105,754,921	V2805I	probably benign	Het
Dsp	A	T	13: 38,193,374	K1712*	probably null	Het
Emilin2	T	C	17: 71,274,090	D547G	probably benign	Het
Erbb3	T	C	10: 128,583,248	H248R	probably benign	Het
Erich3	A	G	3: 154,762,623		probably benign	Het
Fam213b	C	T	4: 154,897,063	V186I	probably benign	Het
Fbn1	T	C	2: 125,309,781	T2518A	probably damaging	Het
Fzd2	G	A	11: 102,605,881	V384M	probably damaging	Het
Gm14085	T	C	2: 122,521,859	S366P	probably damaging	Het
Gpc5	T	A	14: 115,370,098	S371T	probably damaging	Het
Hbb-bh2	T	C	7: 103,839,155	K145R	probably null	Het
Hectd1	G	T	12: 51,744,788	P2558Q	probably damaging	Het
Hgsnat	C	T	8: 25,954,605		probably null	Het
Hirip3	T	C	7: 126,863,475		probably null	Het
Ispd	T	C	12: 36,476,721	C170R	probably benign	Het
Itpkc	T	C	7: 27,208,281	D666G	probably damaging	Het
Jmjd1c	T	A	10: 67,224,809	D693E	probably benign	Het
Katnbl1	T	C	2: 112,406,109	L60P	probably damaging	Het
Kcna1	T	A	6: 126,642,682	E225V	probably damaging	Het
Kcnj6	T	A	16: 94,832,584	M223L	probably damaging	Het
Kcnk7	G	T	19: 5,706,978	V332F	probably benign	Het
Kmt5a	GAA	GA	5: 124,459,885		probably null	Het
Mdga2	C	A	12: 66,568,772	G618V	probably damaging	Het
Mdga2	C	A	12: 66,568,773	G618*	probably null	Het
Morc2b	T	C	17: 33,135,981	E939G	possibly damaging	Het
Mstn	T	A	1: 53,062,065	D100E	probably benign	Het
Mthfd1l	G	A	10: 4,083,877		probably null	Het
Muc20	T	A	16: 32,794,279	T243S	probably damaging	Het
Myo1d	A	T	11: 80,684,421	N156K	probably damaging	Het
Myo7a	A	G	7: 98,099,472		probably null	Het
Naa35	A	T	13: 59,612,676	Q274L	probably damaging	Het
Ncam1	G	A	9: 49,557,172	T329I	probably damaging	Het
Nisch	T	C	14: 31,180,902		probably benign	Het
Nlrp1b	A	T	11: 71,182,811	W69R	probably benign	Het
Nrap	T	A	19: 56,335,255	H1294L	probably damaging	Het
Nsun6	T	A	2: 15,047,213	R56*	probably null	Het
Nudt1	A	G	5: 140,334,623		probably null	Het
Nxph4	T	G	10: 127,526,208	K271N	probably damaging	Het
Olfr1196	T	G	2: 88,701,317	H4P	probably benign	Het
Olfr243	T	C	7: 103,717,112	W173R	probably benign	Het
Olfr366	A	T	2: 37,219,641	R51*	probably null	Het
Olfr78	T	A	7: 102,742,398	I202F	probably damaging	Het
Otud6b	T	A	4: 14,825,617	N71I	probably damaging	Het
Parp8	T	A	13: 116,877,528	D623V	probably damaging	Het
Pcdhb5	T	C	18: 37,320,752	S62P	probably benign	Het
Ppp1r12b	A	G	1: 134,777,452	S833P	probably damaging	Het
Ppp1r1a	T	G	15: 103,533,488	D51A	probably damaging	Het
Prag1	C	A	8: 36,102,898	P212T	probably damaging	Het
Ptdss1	A	G	13: 66,933,637	T44A	probably damaging	Het
Rab14	T	C	2: 35,186,723	H83R	possibly damaging	Het
Rapgef3	C	T	15: 97,761,182	G101E	probably benign	Het
Rimbp3	T	A	16: 17,211,113	D800E	probably benign	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Het
Selenbp1	A	G	3: 94,944,543	D465G	probably damaging	Het
Slc29a1	T	C	17: 45,589,010	D251G	probably damaging	Het
Slc6a11	G	T	6: 114,247,666	V604F	probably benign	Het
Sltm	T	A	9: 70,573,647	D260E	probably damaging	Het
Spta1	G	A	1: 174,179,839	V212M	probably damaging	Het
St6gal2	T	C	17: 55,496,395		probably null	Het
Tc2n	A	G	12: 101,688,992	S235P	probably damaging	Het
Tenm3	T	A	8: 48,417,119	N213I	possibly damaging	Het
Ticam2	T	C	18: 46,560,610	T137A	probably damaging	Het
Ttn	TCCC	TCCCC	2: 76,742,907		probably null	Het
Tyk2	G	A	9: 21,115,249	Q684*	probably null	Het
Ubqln1	A	G	13: 58,179,391	F478S	possibly damaging	Het
Uckl1	G	A	2: 181,574,918	T78I	probably damaging	Het
Uhmk1	A	G	1: 170,200,012	V372A	probably damaging	Het
Unc5c	G	A	3: 141,757,837	V240I	possibly damaging	Het
Ush2a	T	C	1: 188,728,585	L2681P	probably damaging	Het
Vmn2r1	C	T	3: 64,090,182	Q420*	probably null	Het
Vmn2r101	A	T	17: 19,611,922	T727S	probably benign	Het
Vmn2r79	A	G	7: 87,002,631	T413A	probably benign	Het
Vps13c	T	C	9: 67,926,962	V1637A	probably benign	Het
Xpc	A	G	6: 91,492,947	V765A	possibly damaging	Het
Zbtb18	T	G	1: 177,447,347		probably null	Het
Zfp712	A	T	13: 67,052,336	D28E	probably benign	Het
Zfp735	A	G	11: 73,711,475	N415S	possibly damaging	Het

Other mutations in Cfap57

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Cfap57	APN	4	118581001	missense	probably benign	0.01
IGL00508:Cfap57	APN	4	118581170	splice site	probably null
IGL00857:Cfap57	APN	4	118612923	critical splice donor site	probably null
IGL01147:Cfap57	APN	4	118589001	missense	probably damaging	0.97
IGL01396:Cfap57	APN	4	118610595	missense	probably damaging	1.00
IGL01420:Cfap57	APN	4	118612940	missense	probably benign	0.21
IGL01615:Cfap57	APN	4	118600796	missense	probably damaging	1.00
IGL02154:Cfap57	APN	4	118613017	missense	probably damaging	1.00
IGL02161:Cfap57	APN	4	118579372	missense	possibly damaging	0.75
IGL02481:Cfap57	APN	4	118581105	missense	probably damaging	1.00
IGL02483:Cfap57	APN	4	118581105	missense	probably damaging	1.00
IGL02503:Cfap57	APN	4	118569348	critical splice donor site	probably null
IGL02800:Cfap57	APN	4	118614750	missense	probably damaging	1.00
IGL03083:Cfap57	APN	4	118584739	missense	probably damaging	0.96
IGL03146:Cfap57	APN	4	118599019	missense	probably damaging	1.00
IGL03246:Cfap57	APN	4	118576645	missense	probably benign	0.29
IGL03376:Cfap57	APN	4	118584720	missense	probably damaging	0.96
G1Funyon:Cfap57	UTSW	4	118593074	missense	possibly damaging	0.94
R0144:Cfap57	UTSW	4	118584705	missense	probably damaging	1.00
R0184:Cfap57	UTSW	4	118599012	missense	probably damaging	1.00
R0415:Cfap57	UTSW	4	118569431	missense	possibly damaging	0.89
R0515:Cfap57	UTSW	4	118620402	missense	probably damaging	1.00
R0690:Cfap57	UTSW	4	118569727	splice site	probably benign
R0730:Cfap57	UTSW	4	118612920	splice site	probably null
R0737:Cfap57	UTSW	4	118581102	missense	possibly damaging	0.81
R0854:Cfap57	UTSW	4	118561872	missense	probably benign	0.04
R0880:Cfap57	UTSW	4	118581838	nonsense	probably null
R1085:Cfap57	UTSW	4	118595779	missense	probably benign	0.20
R1119:Cfap57	UTSW	4	118606676	nonsense	probably null
R1217:Cfap57	UTSW	4	118606652	missense	possibly damaging	0.67
R1294:Cfap57	UTSW	4	118606534	critical splice donor site	probably null
R1487:Cfap57	UTSW	4	118614781	missense	probably benign	0.01
R1688:Cfap57	UTSW	4	118569646	missense	probably null	0.20
R1709:Cfap57	UTSW	4	118571704	missense	probably benign	0.00
R1719:Cfap57	UTSW	4	118606631	missense	probably benign	0.04
R1782:Cfap57	UTSW	4	118614975	missense	probably damaging	0.98
R1791:Cfap57	UTSW	4	118571724	missense	possibly damaging	0.66
R1850:Cfap57	UTSW	4	118599894	missense	probably damaging	1.00
R1866:Cfap57	UTSW	4	118599927	missense	possibly damaging	0.49
R1912:Cfap57	UTSW	4	118615010	missense	probably damaging	0.96
R1978:Cfap57	UTSW	4	118593132	missense	probably benign	0.03
R2177:Cfap57	UTSW	4	118606688	missense	probably benign	0.00
R2322:Cfap57	UTSW	4	118610725	missense	probably benign
R3905:Cfap57	UTSW	4	118595839	missense	probably damaging	1.00
R4013:Cfap57	UTSW	4	118593143	missense	probably benign	0.01
R4079:Cfap57	UTSW	4	118598997	missense	probably benign	0.34
R4962:Cfap57	UTSW	4	118613065	missense	probably benign	0.21
R4970:Cfap57	UTSW	4	118620371	missense	probably damaging	0.99
R4974:Cfap57	UTSW	4	118593054	missense	probably damaging	1.00
R4999:Cfap57	UTSW	4	118595848	missense	probably benign	0.01
R5482:Cfap57	UTSW	4	118569641	missense	probably benign
R5522:Cfap57	UTSW	4	118595888	missense	probably benign	0.41
R5626:Cfap57	UTSW	4	118614783	missense	probably damaging	1.00
R5685:Cfap57	UTSW	4	118569459	missense	probably benign
R5712:Cfap57	UTSW	4	118614795	missense	probably damaging	1.00
R5961:Cfap57	UTSW	4	118571745	missense	probably benign	0.00
R6244:Cfap57	UTSW	4	118579410	missense	probably damaging	0.99
R6268:Cfap57	UTSW	4	118569451	nonsense	probably null
R6271:Cfap57	UTSW	4	118595759	missense	probably benign	0.13
R6330:Cfap57	UTSW	4	118569396	missense	probably benign
R6439:Cfap57	UTSW	4	118588975	critical splice donor site	probably null
R6639:Cfap57	UTSW	4	118554712	missense	probably benign	0.13
R6722:Cfap57	UTSW	4	118584717	missense	probably damaging	1.00
R7033:Cfap57	UTSW	4	118613126	missense	possibly damaging	0.67
R7143:Cfap57	UTSW	4	118620709	unclassified	probably benign
R7162:Cfap57	UTSW	4	118614931	missense	probably benign
R7174:Cfap57	UTSW	4	118589067	missense	probably benign	0.35
R7210:Cfap57	UTSW	4	118576703	nonsense	probably null
R7242:Cfap57	UTSW	4	118593096	missense	possibly damaging	0.50
R7244:Cfap57	UTSW	4	118554800	nonsense	probably null
R7359:Cfap57	UTSW	4	118598965	missense	probably benign	0.01
R7373:Cfap57	UTSW	4	118614931	missense	probably benign
R7394:Cfap57	UTSW	4	118593137	missense	probably benign	0.00
R7401:Cfap57	UTSW	4	118614931	missense	probably benign
R7412:Cfap57	UTSW	4	118614931	missense	probably benign
R7414:Cfap57	UTSW	4	118614931	missense	probably benign
R7452:Cfap57	UTSW	4	118595784	missense	probably damaging	1.00
R7457:Cfap57	UTSW	4	118589001	missense	probably damaging	0.97
R7559:Cfap57	UTSW	4	118614931	missense	probably benign
R7642:Cfap57	UTSW	4	118614931	missense	probably benign
R7741:Cfap57	UTSW	4	118614931	missense	probably benign
R7744:Cfap57	UTSW	4	118614931	missense	probably benign
R7745:Cfap57	UTSW	4	118614931	missense	probably benign
R7842:Cfap57	UTSW	4	118554755	nonsense	probably null
R7936:Cfap57	UTSW	4	118614931	missense	probably benign
R7940:Cfap57	UTSW	4	118614931	missense	probably benign
R7942:Cfap57	UTSW	4	118614931	missense	probably benign
R8074:Cfap57	UTSW	4	118569625	missense	possibly damaging	0.66
R8301:Cfap57	UTSW	4	118593074	missense	possibly damaging	0.94
R8411:Cfap57	UTSW	4	118614931	missense	probably benign
R8447:Cfap57	UTSW	4	118614931	missense	probably benign
R8491:Cfap57	UTSW	4	118614931	missense	probably benign
R8524:Cfap57	UTSW	4	118614931	missense	probably benign
R8670:Cfap57	UTSW	4	118614925	missense	possibly damaging	0.91
R8707:Cfap57	UTSW	4	118593006	missense	probably benign	0.04
R8790:Cfap57	UTSW	4	118581914	missense	possibly damaging	0.59
R8941:Cfap57	UTSW	4	118569602	missense	probably damaging	0.99
R9139:Cfap57	UTSW	4	118554851	missense	probably benign	0.02
R9212:Cfap57	UTSW	4	118579452	missense	possibly damaging	0.95
X0022:Cfap57	UTSW	4	118614745	missense	probably benign
Z1088:Cfap57	UTSW	4	118581882	missense	probably benign	0.22
Z1177:Cfap57	UTSW	4	118598956	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- CTGGCATGACACAGTAGAGAACCC -3'
(R):5'- TGTATTAGAGCCCCTGAGTTTGTCTCC -3'

Sequencing Primer
(F):5'- CTTCTGTAGCACTGAGGAGC -3'
(R):5'- CCTCCCCAAGTTGGTGTG -3'

Posted On

2014-05-09