Mutagenetix > Incidental Mutation

Incidental Mutation 'R1676:Itpkc'

188071

Institutional Source

Beutler Lab

Gene Symbol

Itpkc

Ensembl Gene

ENSMUSG00000003752

Gene Name

inositol 1,4,5-trisphosphate 3-kinase C

Synonyms

MMRRC Submission

039712-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.443) question?

Stock #

R1676 (G1)

Quality Score

119

Status

Not validated

Chromosome

Chromosomal Location

27207172-27228661 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 27208281 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 666 (D666G)

Ref Sequence

ENSEMBL: ENSMUSP00000003850 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003850] [ENSMUST00000108379] [ENSMUST00000179391]

AlphaFold

Q7TS72

Predicted Effect

probably damaging
Transcript: ENSMUST00000003850
AA Change: D666G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000003850
Gene: ENSMUSG00000003752
AA Change: D666G

Domain	Start	End	E-Value	Type
low complexity region	28	59	N/A	INTRINSIC
low complexity region	346	363	N/A	INTRINSIC
Pfam:IPK	462	673	3.7e-42	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000108379

SMART Domains

Protein: ENSMUSP00000104016
Gene: ENSMUSG00000078786

Domain	Start	End	E-Value	Type
low complexity region	26	42	N/A	INTRINSIC
low complexity region	50	80	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000116883

Predicted Effect

probably benign
Transcript: ENSMUST00000123108

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147170

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149067

Predicted Effect

probably benign
Transcript: ENSMUST00000155931

SMART Domains

Protein: ENSMUSP00000123290
Gene: ENSMUSG00000078786

Domain	Start	End	E-Value	Type
low complexity region	14	44	N/A	INTRINSIC
low complexity region	253	264	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000179391

SMART Domains

Protein: ENSMUSP00000137189
Gene: ENSMUSG00000078786

Domain	Start	End	E-Value	Type
low complexity region	26	42	N/A	INTRINSIC
low complexity region	50	80	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the inositol 1,4,5-trisphosphate [Ins(1,4,5)P(3)] 3-kinase family of enzymes that catalyze the phosphorylation of inositol 1,4,5-trisphosphate to 1,3,4,5-tetrakisphosphate. The encoded protein is localized to the nucleus and cytoplasm and has both nuclear import and nuclear export activity. Single nucleotide polymorphisms in this gene are associated with Kawasaki disease.[provided by RefSeq, Sep 2009]
PHENOTYPE: No overt phenotype reported. Thymocyte development was normal in homozygous null mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810021J22Rik	G	T	11: 58,880,993	A434S	possibly damaging	Het
Abhd8	T	A	8: 71,461,873	D37V	probably damaging	Het
Acvr2a	G	A	2: 48,873,083	S97N	probably benign	Het
Ampd3	T	A	7: 110,795,733	H296Q	probably damaging	Het
Arid4a	G	A	12: 71,075,338	S509N	probably benign	Het
Cap2	T	G	13: 46,637,859	H167Q	probably damaging	Het
Car8	A	G	4: 8,185,616	L180S	probably damaging	Het
Casp8	T	A	1: 58,844,416	I314N	probably damaging	Het
Cavin2	T	A	1: 51,301,171	S336T	probably benign	Het
Cdc14b	A	T	13: 64,225,602	I119N	possibly damaging	Het
Cemip	T	A	7: 83,964,038	I651F	possibly damaging	Het
Cfap57	T	A	4: 118,595,940	D522V	probably damaging	Het
Clrn3	A	T	7: 135,518,578	V93D	probably damaging	Het
Cyp4f39	A	G	17: 32,482,202	D222G	probably benign	Het
D5Ertd579e	A	G	5: 36,616,109	V314A	probably benign	Het
Dchs1	C	T	7: 105,754,921	V2805I	probably benign	Het
Dsp	A	T	13: 38,193,374	K1712*	probably null	Het
Emilin2	T	C	17: 71,274,090	D547G	probably benign	Het
Erbb3	T	C	10: 128,583,248	H248R	probably benign	Het
Erich3	A	G	3: 154,762,623		probably benign	Het
Fam213b	C	T	4: 154,897,063	V186I	probably benign	Het
Fbn1	T	C	2: 125,309,781	T2518A	probably damaging	Het
Fzd2	G	A	11: 102,605,881	V384M	probably damaging	Het
Gm14085	T	C	2: 122,521,859	S366P	probably damaging	Het
Gpc5	T	A	14: 115,370,098	S371T	probably damaging	Het
Hbb-bh2	T	C	7: 103,839,155	K145R	probably null	Het
Hectd1	G	T	12: 51,744,788	P2558Q	probably damaging	Het
Hgsnat	C	T	8: 25,954,605		probably null	Het
Hirip3	T	C	7: 126,863,475		probably null	Het
Ispd	T	C	12: 36,476,721	C170R	probably benign	Het
Jmjd1c	T	A	10: 67,224,809	D693E	probably benign	Het
Katnbl1	T	C	2: 112,406,109	L60P	probably damaging	Het
Kcna1	T	A	6: 126,642,682	E225V	probably damaging	Het
Kcnj6	T	A	16: 94,832,584	M223L	probably damaging	Het
Kcnk7	G	T	19: 5,706,978	V332F	probably benign	Het
Kmt5a	GAA	GA	5: 124,459,885		probably null	Het
Mdga2	C	A	12: 66,568,772	G618V	probably damaging	Het
Mdga2	C	A	12: 66,568,773	G618*	probably null	Het
Morc2b	T	C	17: 33,135,981	E939G	possibly damaging	Het
Mstn	T	A	1: 53,062,065	D100E	probably benign	Het
Mthfd1l	G	A	10: 4,083,877		probably null	Het
Muc20	T	A	16: 32,794,279	T243S	probably damaging	Het
Myo1d	A	T	11: 80,684,421	N156K	probably damaging	Het
Myo7a	A	G	7: 98,099,472		probably null	Het
Naa35	A	T	13: 59,612,676	Q274L	probably damaging	Het
Ncam1	G	A	9: 49,557,172	T329I	probably damaging	Het
Nisch	T	C	14: 31,180,902		probably benign	Het
Nlrp1b	A	T	11: 71,182,811	W69R	probably benign	Het
Nrap	T	A	19: 56,335,255	H1294L	probably damaging	Het
Nsun6	T	A	2: 15,047,213	R56*	probably null	Het
Nudt1	A	G	5: 140,334,623		probably null	Het
Nxph4	T	G	10: 127,526,208	K271N	probably damaging	Het
Olfr1196	T	G	2: 88,701,317	H4P	probably benign	Het
Olfr243	T	C	7: 103,717,112	W173R	probably benign	Het
Olfr366	A	T	2: 37,219,641	R51*	probably null	Het
Olfr78	T	A	7: 102,742,398	I202F	probably damaging	Het
Otud6b	T	A	4: 14,825,617	N71I	probably damaging	Het
Parp8	T	A	13: 116,877,528	D623V	probably damaging	Het
Pcdhb5	T	C	18: 37,320,752	S62P	probably benign	Het
Ppp1r12b	A	G	1: 134,777,452	S833P	probably damaging	Het
Ppp1r1a	T	G	15: 103,533,488	D51A	probably damaging	Het
Prag1	C	A	8: 36,102,898	P212T	probably damaging	Het
Ptdss1	A	G	13: 66,933,637	T44A	probably damaging	Het
Rab14	T	C	2: 35,186,723	H83R	possibly damaging	Het
Rapgef3	C	T	15: 97,761,182	G101E	probably benign	Het
Rimbp3	T	A	16: 17,211,113	D800E	probably benign	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Het
Selenbp1	A	G	3: 94,944,543	D465G	probably damaging	Het
Slc29a1	T	C	17: 45,589,010	D251G	probably damaging	Het
Slc6a11	G	T	6: 114,247,666	V604F	probably benign	Het
Sltm	T	A	9: 70,573,647	D260E	probably damaging	Het
Spta1	G	A	1: 174,179,839	V212M	probably damaging	Het
St6gal2	T	C	17: 55,496,395		probably null	Het
Tc2n	A	G	12: 101,688,992	S235P	probably damaging	Het
Tenm3	T	A	8: 48,417,119	N213I	possibly damaging	Het
Ticam2	T	C	18: 46,560,610	T137A	probably damaging	Het
Ttn	TCCC	TCCCC	2: 76,742,907		probably null	Het
Tyk2	G	A	9: 21,115,249	Q684*	probably null	Het
Ubqln1	A	G	13: 58,179,391	F478S	possibly damaging	Het
Uckl1	G	A	2: 181,574,918	T78I	probably damaging	Het
Uhmk1	A	G	1: 170,200,012	V372A	probably damaging	Het
Unc5c	G	A	3: 141,757,837	V240I	possibly damaging	Het
Ush2a	T	C	1: 188,728,585	L2681P	probably damaging	Het
Vmn2r1	C	T	3: 64,090,182	Q420*	probably null	Het
Vmn2r101	A	T	17: 19,611,922	T727S	probably benign	Het
Vmn2r79	A	G	7: 87,002,631	T413A	probably benign	Het
Vps13c	T	C	9: 67,926,962	V1637A	probably benign	Het
Xpc	A	G	6: 91,492,947	V765A	possibly damaging	Het
Zbtb18	T	G	1: 177,447,347		probably null	Het
Zfp712	A	T	13: 67,052,336	D28E	probably benign	Het
Zfp735	A	G	11: 73,711,475	N415S	possibly damaging	Het

Other mutations in Itpkc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01751:Itpkc	APN	7	27213066	unclassified	probably benign
IGL01774:Itpkc	APN	7	27212370	missense	probably benign	0.05
IGL02134:Itpkc	APN	7	27227875	nonsense	probably null
IGL02719:Itpkc	APN	7	27228050	missense	possibly damaging	0.92
R0284:Itpkc	UTSW	7	27214543	nonsense	probably null
R0364:Itpkc	UTSW	7	27227749	missense	possibly damaging	0.80
R0403:Itpkc	UTSW	7	27208345	missense	probably benign	0.01
R1175:Itpkc	UTSW	7	27227770	missense	probably benign	0.00
R1813:Itpkc	UTSW	7	27208380	missense	probably damaging	1.00
R1896:Itpkc	UTSW	7	27208380	missense	probably damaging	1.00
R1944:Itpkc	UTSW	7	27227659	missense	possibly damaging	0.55
R2142:Itpkc	UTSW	7	27219650	missense	possibly damaging	0.83
R3030:Itpkc	UTSW	7	27212308	splice site	probably null
R3738:Itpkc	UTSW	7	27227604	missense	possibly damaging	0.95
R3739:Itpkc	UTSW	7	27227604	missense	possibly damaging	0.95
R3754:Itpkc	UTSW	7	27228432	missense	probably damaging	1.00
R3851:Itpkc	UTSW	7	27227612	missense	probably benign	0.00
R3852:Itpkc	UTSW	7	27227612	missense	probably benign	0.00
R3916:Itpkc	UTSW	7	27228303	missense	probably benign	0.09
R3963:Itpkc	UTSW	7	27227509	missense	probably damaging	1.00
R5770:Itpkc	UTSW	7	27212988	missense	probably damaging	1.00
R5943:Itpkc	UTSW	7	27212979	missense	possibly damaging	0.69
R6012:Itpkc	UTSW	7	27228065	missense	probably damaging	0.98
R6835:Itpkc	UTSW	7	27227815	missense	probably benign	0.02
R7107:Itpkc	UTSW	7	27228277	missense	probably benign	0.15
R7379:Itpkc	UTSW	7	27227769	missense	probably benign	0.12
R8305:Itpkc	UTSW	7	27214519	missense	probably damaging	1.00
R8365:Itpkc	UTSW	7	27212352	missense	probably damaging	1.00
R9216:Itpkc	UTSW	7	27228004	missense	probably benign	0.19
R9634:Itpkc	UTSW	7	27214455	missense	probably benign	0.29
R9764:Itpkc	UTSW	7	27227797	missense	probably benign	0.00
Z1176:Itpkc	UTSW	7	27227638	missense	probably benign	0.01
Z1177:Itpkc	UTSW	7	27227781	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TCTTCACAAATGATGCCTGGTCCTC -3'
(R):5'- AGGTAGTGGGCAGTTCCCTTCTC -3'

Sequencing Primer
(F):5'- GCTCTAGGCTCAAAGAGCTGAC -3'
(R):5'- GGCAGTTCCCTTCTCTTTGTG -3'

Posted On

2014-05-09