Incidental Mutation 'R1676:Hirip3'
ID188081
Institutional Source Beutler Lab
Gene Symbol Hirip3
Ensembl Gene ENSMUSG00000042606
Gene NameHIRA interacting protein 3
Synonyms
MMRRC Submission 039712-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1676 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location126861972-126865377 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 126863475 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037248] [ENSMUST00000050833] [ENSMUST00000071268] [ENSMUST00000106342] [ENSMUST00000106343] [ENSMUST00000129812] [ENSMUST00000132808] [ENSMUST00000205349] [ENSMUST00000206349] [ENSMUST00000206968] [ENSMUST00000214525]
Predicted Effect probably benign
Transcript: ENSMUST00000037248
AA Change: V201A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000035535
Gene: ENSMUSG00000042606
AA Change: V201A

DomainStartEndE-ValueType
low complexity region 96 113 N/A INTRINSIC
low complexity region 148 164 N/A INTRINSIC
low complexity region 229 244 N/A INTRINSIC
low complexity region 286 339 N/A INTRINSIC
low complexity region 379 390 N/A INTRINSIC
low complexity region 405 419 N/A INTRINSIC
internal_repeat_1 420 443 6.44e-5 PROSPERO
internal_repeat_1 440 463 6.44e-5 PROSPERO
CHZ 529 565 1.17e-11 SMART
Predicted Effect probably null
Transcript: ENSMUST00000050833
SMART Domains Protein: ENSMUSP00000049851
Gene: ENSMUSG00000030689

DomainStartEndE-ValueType
low complexity region 25 42 N/A INTRINSIC
low complexity region 59 81 N/A INTRINSIC
low complexity region 86 108 N/A INTRINSIC
low complexity region 116 132 N/A INTRINSIC
low complexity region 163 171 N/A INTRINSIC
low complexity region 184 199 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000071268
SMART Domains Protein: ENSMUSP00000071246
Gene: ENSMUSG00000059981

DomainStartEndE-ValueType
S_TKc 28 281 6.42e-86 SMART
low complexity region 319 333 N/A INTRINSIC
coiled coil region 373 401 N/A INTRINSIC
low complexity region 449 465 N/A INTRINSIC
coiled coil region 493 526 N/A INTRINSIC
low complexity region 558 570 N/A INTRINSIC
coiled coil region 579 608 N/A INTRINSIC
low complexity region 620 639 N/A INTRINSIC
coiled coil region 821 859 N/A INTRINSIC
low complexity region 863 892 N/A INTRINSIC
low complexity region 931 954 N/A INTRINSIC
low complexity region 963 972 N/A INTRINSIC
low complexity region 977 992 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106342
SMART Domains Protein: ENSMUSP00000101949
Gene: ENSMUSG00000030689

DomainStartEndE-ValueType
low complexity region 44 66 N/A INTRINSIC
low complexity region 74 90 N/A INTRINSIC
low complexity region 121 129 N/A INTRINSIC
low complexity region 142 157 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106343
SMART Domains Protein: ENSMUSP00000101950
Gene: ENSMUSG00000030689

DomainStartEndE-ValueType
coiled coil region 10 55 N/A INTRINSIC
low complexity region 64 81 N/A INTRINSIC
low complexity region 98 120 N/A INTRINSIC
low complexity region 125 147 N/A INTRINSIC
low complexity region 155 171 N/A INTRINSIC
low complexity region 202 210 N/A INTRINSIC
low complexity region 223 238 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125624
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129746
Predicted Effect probably null
Transcript: ENSMUST00000129812
SMART Domains Protein: ENSMUSP00000114606
Gene: ENSMUSG00000030689

DomainStartEndE-ValueType
SCOP:d1iw7c_ 15 37 4e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130371
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132552
Predicted Effect probably benign
Transcript: ENSMUST00000132808
SMART Domains Protein: ENSMUSP00000115145
Gene: ENSMUSG00000042606

DomainStartEndE-ValueType
low complexity region 36 53 N/A INTRINSIC
low complexity region 88 104 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144056
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146120
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150942
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153764
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154881
Predicted Effect probably null
Transcript: ENSMUST00000205349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205512
Predicted Effect probably null
Transcript: ENSMUST00000205619
Predicted Effect probably benign
Transcript: ENSMUST00000205958
Predicted Effect probably null
Transcript: ENSMUST00000206349
Predicted Effect probably null
Transcript: ENSMUST00000206968
Predicted Effect probably benign
Transcript: ENSMUST00000214525
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The HIRA protein shares sequence similarity with Hir1p and Hir2p, the two corepressors of histone gene transcription characterized in the yeast, Saccharomyces cerevisiae. The structural features of the HIRA protein suggest that it may function as part of a multiprotein complex. Several cDNAs encoding HIRA-interacting proteins, or HIRIPs, have been identified. In vitro, the protein encoded by this gene binds HIRA, as well as H2B and H3 core histones, indicating that a complex containing HIRA-HIRIP3 could function in some aspects of chromatin and histone metabolism. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.[provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik G T 11: 58,880,993 A434S possibly damaging Het
Abhd8 T A 8: 71,461,873 D37V probably damaging Het
Acvr2a G A 2: 48,873,083 S97N probably benign Het
Ampd3 T A 7: 110,795,733 H296Q probably damaging Het
Arid4a G A 12: 71,075,338 S509N probably benign Het
Cap2 T G 13: 46,637,859 H167Q probably damaging Het
Car8 A G 4: 8,185,616 L180S probably damaging Het
Casp8 T A 1: 58,844,416 I314N probably damaging Het
Cavin2 T A 1: 51,301,171 S336T probably benign Het
Cdc14b A T 13: 64,225,602 I119N possibly damaging Het
Cemip T A 7: 83,964,038 I651F possibly damaging Het
Cfap57 T A 4: 118,595,940 D522V probably damaging Het
Clrn3 A T 7: 135,518,578 V93D probably damaging Het
Cyp4f39 A G 17: 32,482,202 D222G probably benign Het
D5Ertd579e A G 5: 36,616,109 V314A probably benign Het
Dchs1 C T 7: 105,754,921 V2805I probably benign Het
Dsp A T 13: 38,193,374 K1712* probably null Het
Emilin2 T C 17: 71,274,090 D547G probably benign Het
Erbb3 T C 10: 128,583,248 H248R probably benign Het
Erich3 A G 3: 154,762,623 probably benign Het
Fam213b C T 4: 154,897,063 V186I probably benign Het
Fbn1 T C 2: 125,309,781 T2518A probably damaging Het
Fzd2 G A 11: 102,605,881 V384M probably damaging Het
Gm14085 T C 2: 122,521,859 S366P probably damaging Het
Gpc5 T A 14: 115,370,098 S371T probably damaging Het
Hbb-bh2 T C 7: 103,839,155 K145R probably null Het
Hectd1 G T 12: 51,744,788 P2558Q probably damaging Het
Hgsnat C T 8: 25,954,605 probably null Het
Ispd T C 12: 36,476,721 C170R probably benign Het
Itpkc T C 7: 27,208,281 D666G probably damaging Het
Jmjd1c T A 10: 67,224,809 D693E probably benign Het
Katnbl1 T C 2: 112,406,109 L60P probably damaging Het
Kcna1 T A 6: 126,642,682 E225V probably damaging Het
Kcnj6 T A 16: 94,832,584 M223L probably damaging Het
Kcnk7 G T 19: 5,706,978 V332F probably benign Het
Kmt5a GAA GA 5: 124,459,885 probably null Het
Mdga2 C A 12: 66,568,772 G618V probably damaging Het
Mdga2 C A 12: 66,568,773 G618* probably null Het
Morc2b T C 17: 33,135,981 E939G possibly damaging Het
Mstn T A 1: 53,062,065 D100E probably benign Het
Mthfd1l G A 10: 4,083,877 probably null Het
Muc20 T A 16: 32,794,279 T243S probably damaging Het
Myo1d A T 11: 80,684,421 N156K probably damaging Het
Myo7a A G 7: 98,099,472 probably null Het
Naa35 A T 13: 59,612,676 Q274L probably damaging Het
Ncam1 G A 9: 49,557,172 T329I probably damaging Het
Nisch T C 14: 31,180,902 probably benign Het
Nlrp1b A T 11: 71,182,811 W69R probably benign Het
Nrap T A 19: 56,335,255 H1294L probably damaging Het
Nsun6 T A 2: 15,047,213 R56* probably null Het
Nudt1 A G 5: 140,334,623 probably null Het
Nxph4 T G 10: 127,526,208 K271N probably damaging Het
Olfr1196 T G 2: 88,701,317 H4P probably benign Het
Olfr243 T C 7: 103,717,112 W173R probably benign Het
Olfr366 A T 2: 37,219,641 R51* probably null Het
Olfr78 T A 7: 102,742,398 I202F probably damaging Het
Otud6b T A 4: 14,825,617 N71I probably damaging Het
Parp8 T A 13: 116,877,528 D623V probably damaging Het
Pcdhb5 T C 18: 37,320,752 S62P probably benign Het
Ppp1r12b A G 1: 134,777,452 S833P probably damaging Het
Ppp1r1a T G 15: 103,533,488 D51A probably damaging Het
Prag1 C A 8: 36,102,898 P212T probably damaging Het
Ptdss1 A G 13: 66,933,637 T44A probably damaging Het
Rab14 T C 2: 35,186,723 H83R possibly damaging Het
Rapgef3 C T 15: 97,761,182 G101E probably benign Het
Rimbp3 T A 16: 17,211,113 D800E probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Selenbp1 A G 3: 94,944,543 D465G probably damaging Het
Slc29a1 T C 17: 45,589,010 D251G probably damaging Het
Slc6a11 G T 6: 114,247,666 V604F probably benign Het
Sltm T A 9: 70,573,647 D260E probably damaging Het
Spta1 G A 1: 174,179,839 V212M probably damaging Het
St6gal2 T C 17: 55,496,395 probably null Het
Tc2n A G 12: 101,688,992 S235P probably damaging Het
Tenm3 T A 8: 48,417,119 N213I possibly damaging Het
Ticam2 T C 18: 46,560,610 T137A probably damaging Het
Ttn TCCC TCCCC 2: 76,742,907 probably null Het
Tyk2 G A 9: 21,115,249 Q684* probably null Het
Ubqln1 A G 13: 58,179,391 F478S possibly damaging Het
Uckl1 G A 2: 181,574,918 T78I probably damaging Het
Uhmk1 A G 1: 170,200,012 V372A probably damaging Het
Unc5c G A 3: 141,757,837 V240I possibly damaging Het
Ush2a T C 1: 188,728,585 L2681P probably damaging Het
Vmn2r1 C T 3: 64,090,182 Q420* probably null Het
Vmn2r101 A T 17: 19,611,922 T727S probably benign Het
Vmn2r79 A G 7: 87,002,631 T413A probably benign Het
Vps13c T C 9: 67,926,962 V1637A probably benign Het
Xpc A G 6: 91,492,947 V765A possibly damaging Het
Zbtb18 T G 1: 177,447,347 probably null Het
Zfp712 A T 13: 67,052,336 D28E probably benign Het
Zfp735 A G 11: 73,711,475 N415S possibly damaging Het
Other mutations in Hirip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01523:Hirip3 APN 7 126862704 missense probably damaging 1.00
IGL01531:Hirip3 APN 7 126863376 missense possibly damaging 0.72
IGL01885:Hirip3 APN 7 126864209 missense probably benign 0.00
R0126:Hirip3 UTSW 7 126863442 missense probably damaging 0.99
R0270:Hirip3 UTSW 7 126863191 missense probably damaging 0.99
R1185:Hirip3 UTSW 7 126863660 frame shift probably null
R1185:Hirip3 UTSW 7 126863660 frame shift probably null
R1185:Hirip3 UTSW 7 126863660 frame shift probably null
R1792:Hirip3 UTSW 7 126862620 missense probably damaging 0.98
R1951:Hirip3 UTSW 7 126862866 missense probably damaging 0.96
R2327:Hirip3 UTSW 7 126862866 missense probably damaging 0.96
R4674:Hirip3 UTSW 7 126864662 critical splice donor site probably null
R5024:Hirip3 UTSW 7 126864489 splice site probably null
R5523:Hirip3 UTSW 7 126863862 missense possibly damaging 0.62
R6876:Hirip3 UTSW 7 126864149 missense probably damaging 1.00
R7181:Hirip3 UTSW 7 126864063 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGAGAGCACAGATGAAGACCACC -3'
(R):5'- CCTGACTTTGTAGTGCCTTGAGCAG -3'

Sequencing Primer
(F):5'- CAAACAGACCTGGATGCAAAG -3'
(R):5'- tccctcctcactgctgtc -3'
Posted On2014-05-09