Mutagenetix > Incidental Mutation

Incidental Mutation 'R1676:Tenm3'

188086

Institutional Source

Beutler Lab

Gene Symbol

Tenm3

Ensembl Gene

ENSMUSG00000031561

Gene Name

teneurin transmembrane protein 3

Synonyms

Ten-m3, Odz3, 2610100B16Rik

MMRRC Submission

039712-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.755) question?

Stock #

R1676 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

48227682-48843951 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 48417119 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 213 (N213I)

Ref Sequence

ENSEMBL: ENSMUSP00000033965 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033965] [ENSMUST00000110343] [ENSMUST00000110345] [ENSMUST00000110346] [ENSMUST00000190840] [ENSMUST00000211976]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000033965
AA Change: N213I

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000033965
Gene: ENSMUSG00000031561
AA Change: N213I

Domain	Start	End	E-Value	Type
Pfam:Ten_N	11	177	6.9e-91	PFAM
Pfam:Ten_N	171	308	1e-72	PFAM
transmembrane domain	309	331	N/A	INTRINSIC
EGF	517	545	2.32e-1	SMART
EGF_like	548	576	4.11e1	SMART
EGF	581	610	1.69e1	SMART
EGF	613	642	1.35e-2	SMART
EGF	647	677	6.11e-1	SMART
EGF	680	708	7.95e0	SMART
EGF	711	739	1.28e1	SMART
EGF	751	783	1.64e-1	SMART
PDB:1RWL\|A	1276	1511	9e-6	PDB
low complexity region	2593	2602	N/A	INTRINSIC
Pfam:Tox-GHH	2631	2708	1.5e-34	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000110343

SMART Domains

Protein: ENSMUSP00000105972
Gene: ENSMUSG00000031561

Domain	Start	End	E-Value	Type
Pfam:Ten_N	1	36	2.3e-15	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000110345

SMART Domains

Protein: ENSMUSP00000105974
Gene: ENSMUSG00000031561

Domain	Start	End	E-Value	Type
Pfam:Ten_N	1	36	2.3e-15	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000110346

SMART Domains

Protein: ENSMUSP00000105975
Gene: ENSMUSG00000031561

Domain	Start	End	E-Value	Type
Pfam:Ten_N	1	36	1.1e-14	PFAM
transmembrane domain	37	59	N/A	INTRINSIC
EGF	245	273	2.32e-1	SMART
EGF_like	276	304	4.11e1	SMART
EGF	309	338	1.69e1	SMART
EGF	341	370	1.35e-2	SMART
EGF	375	405	6.11e-1	SMART
EGF	408	436	7.95e0	SMART
EGF	439	467	1.28e1	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000190840
AA Change: N213I

SMART Domains

Protein: ENSMUSP00000140141
Gene: ENSMUSG00000031561
AA Change: N213I

Domain	Start	End	E-Value	Type
Pfam:Ten_N	10	182	7.6e-77	PFAM
Pfam:Ten_N	168	308	6.6e-50	PFAM
transmembrane domain	309	331	N/A	INTRINSIC
EGF	517	545	2.32e-1	SMART
EGF_like	548	576	4.11e1	SMART
EGF	581	610	1.69e1	SMART
EGF	613	642	1.35e-2	SMART
EGF	647	677	6.11e-1	SMART
EGF	680	708	7.95e0	SMART
EGF	711	739	1.28e1	SMART
EGF	751	783	1.64e-1	SMART
PDB:1RWL\|A	1276	1511	9e-6	PDB
low complexity region	2593	2602	N/A	INTRINSIC
Pfam:Tox-GHH	2630	2708	3.2e-35	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000211976

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large transmembrane protein that may be involved in the regulation of neuronal development. Mutation in this gene causes microphthalmia. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null mutation display abnormal ipsilateral retinal ganglion cell projections and impaired performance in visually mediated behavioral tasks. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810021J22Rik	G	T	11: 58,880,993	A434S	possibly damaging	Het
Abhd8	T	A	8: 71,461,873	D37V	probably damaging	Het
Acvr2a	G	A	2: 48,873,083	S97N	probably benign	Het
Ampd3	T	A	7: 110,795,733	H296Q	probably damaging	Het
Arid4a	G	A	12: 71,075,338	S509N	probably benign	Het
Cap2	T	G	13: 46,637,859	H167Q	probably damaging	Het
Car8	A	G	4: 8,185,616	L180S	probably damaging	Het
Casp8	T	A	1: 58,844,416	I314N	probably damaging	Het
Cavin2	T	A	1: 51,301,171	S336T	probably benign	Het
Cdc14b	A	T	13: 64,225,602	I119N	possibly damaging	Het
Cemip	T	A	7: 83,964,038	I651F	possibly damaging	Het
Cfap57	T	A	4: 118,595,940	D522V	probably damaging	Het
Clrn3	A	T	7: 135,518,578	V93D	probably damaging	Het
Cyp4f39	A	G	17: 32,482,202	D222G	probably benign	Het
D5Ertd579e	A	G	5: 36,616,109	V314A	probably benign	Het
Dchs1	C	T	7: 105,754,921	V2805I	probably benign	Het
Dsp	A	T	13: 38,193,374	K1712*	probably null	Het
Emilin2	T	C	17: 71,274,090	D547G	probably benign	Het
Erbb3	T	C	10: 128,583,248	H248R	probably benign	Het
Erich3	A	G	3: 154,762,623		probably benign	Het
Fam213b	C	T	4: 154,897,063	V186I	probably benign	Het
Fbn1	T	C	2: 125,309,781	T2518A	probably damaging	Het
Fzd2	G	A	11: 102,605,881	V384M	probably damaging	Het
Gm14085	T	C	2: 122,521,859	S366P	probably damaging	Het
Gpc5	T	A	14: 115,370,098	S371T	probably damaging	Het
Hbb-bh2	T	C	7: 103,839,155	K145R	probably null	Het
Hectd1	G	T	12: 51,744,788	P2558Q	probably damaging	Het
Hgsnat	C	T	8: 25,954,605		probably null	Het
Hirip3	T	C	7: 126,863,475		probably null	Het
Ispd	T	C	12: 36,476,721	C170R	probably benign	Het
Itpkc	T	C	7: 27,208,281	D666G	probably damaging	Het
Jmjd1c	T	A	10: 67,224,809	D693E	probably benign	Het
Katnbl1	T	C	2: 112,406,109	L60P	probably damaging	Het
Kcna1	T	A	6: 126,642,682	E225V	probably damaging	Het
Kcnj6	T	A	16: 94,832,584	M223L	probably damaging	Het
Kcnk7	G	T	19: 5,706,978	V332F	probably benign	Het
Kmt5a	GAA	GA	5: 124,459,885		probably null	Het
Mdga2	C	A	12: 66,568,772	G618V	probably damaging	Het
Mdga2	C	A	12: 66,568,773	G618*	probably null	Het
Morc2b	T	C	17: 33,135,981	E939G	possibly damaging	Het
Mstn	T	A	1: 53,062,065	D100E	probably benign	Het
Mthfd1l	G	A	10: 4,083,877		probably null	Het
Muc20	T	A	16: 32,794,279	T243S	probably damaging	Het
Myo1d	A	T	11: 80,684,421	N156K	probably damaging	Het
Myo7a	A	G	7: 98,099,472		probably null	Het
Naa35	A	T	13: 59,612,676	Q274L	probably damaging	Het
Ncam1	G	A	9: 49,557,172	T329I	probably damaging	Het
Nisch	T	C	14: 31,180,902		probably benign	Het
Nlrp1b	A	T	11: 71,182,811	W69R	probably benign	Het
Nrap	T	A	19: 56,335,255	H1294L	probably damaging	Het
Nsun6	T	A	2: 15,047,213	R56*	probably null	Het
Nudt1	A	G	5: 140,334,623		probably null	Het
Nxph4	T	G	10: 127,526,208	K271N	probably damaging	Het
Olfr1196	T	G	2: 88,701,317	H4P	probably benign	Het
Olfr243	T	C	7: 103,717,112	W173R	probably benign	Het
Olfr366	A	T	2: 37,219,641	R51*	probably null	Het
Olfr78	T	A	7: 102,742,398	I202F	probably damaging	Het
Otud6b	T	A	4: 14,825,617	N71I	probably damaging	Het
Parp8	T	A	13: 116,877,528	D623V	probably damaging	Het
Pcdhb5	T	C	18: 37,320,752	S62P	probably benign	Het
Ppp1r12b	A	G	1: 134,777,452	S833P	probably damaging	Het
Ppp1r1a	T	G	15: 103,533,488	D51A	probably damaging	Het
Prag1	C	A	8: 36,102,898	P212T	probably damaging	Het
Ptdss1	A	G	13: 66,933,637	T44A	probably damaging	Het
Rab14	T	C	2: 35,186,723	H83R	possibly damaging	Het
Rapgef3	C	T	15: 97,761,182	G101E	probably benign	Het
Rimbp3	T	A	16: 17,211,113	D800E	probably benign	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Het
Selenbp1	A	G	3: 94,944,543	D465G	probably damaging	Het
Slc29a1	T	C	17: 45,589,010	D251G	probably damaging	Het
Slc6a11	G	T	6: 114,247,666	V604F	probably benign	Het
Sltm	T	A	9: 70,573,647	D260E	probably damaging	Het
Spta1	G	A	1: 174,179,839	V212M	probably damaging	Het
St6gal2	T	C	17: 55,496,395		probably null	Het
Tc2n	A	G	12: 101,688,992	S235P	probably damaging	Het
Ticam2	T	C	18: 46,560,610	T137A	probably damaging	Het
Ttn	TCCC	TCCCC	2: 76,742,907		probably null	Het
Tyk2	G	A	9: 21,115,249	Q684*	probably null	Het
Ubqln1	A	G	13: 58,179,391	F478S	possibly damaging	Het
Uckl1	G	A	2: 181,574,918	T78I	probably damaging	Het
Uhmk1	A	G	1: 170,200,012	V372A	probably damaging	Het
Unc5c	G	A	3: 141,757,837	V240I	possibly damaging	Het
Ush2a	T	C	1: 188,728,585	L2681P	probably damaging	Het
Vmn2r1	C	T	3: 64,090,182	Q420*	probably null	Het
Vmn2r101	A	T	17: 19,611,922	T727S	probably benign	Het
Vmn2r79	A	G	7: 87,002,631	T413A	probably benign	Het
Vps13c	T	C	9: 67,926,962	V1637A	probably benign	Het
Xpc	A	G	6: 91,492,947	V765A	possibly damaging	Het
Zbtb18	T	G	1: 177,447,347		probably null	Het
Zfp712	A	T	13: 67,052,336	D28E	probably benign	Het
Zfp735	A	G	11: 73,711,475	N415S	possibly damaging	Het

Other mutations in Tenm3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00272:Tenm3	APN	8	48417060	missense	probably damaging	1.00
IGL00538:Tenm3	APN	8	48236025	missense	probably damaging	1.00
IGL00719:Tenm3	APN	8	48279042	missense	probably benign	0.39
IGL00720:Tenm3	APN	8	48276421	missense	probably damaging	0.98
IGL00870:Tenm3	APN	8	48417132	missense	probably benign	0.00
IGL00976:Tenm3	APN	8	48256841	missense	probably benign	0.14
IGL01469:Tenm3	APN	8	48236423	missense	probably damaging	1.00
IGL01508:Tenm3	APN	8	48276645	missense	probably benign	0.09
IGL01590:Tenm3	APN	8	48228802	missense	probably damaging	1.00
IGL01610:Tenm3	APN	8	48254477	missense	probably damaging	1.00
IGL01874:Tenm3	APN	8	48236758	nonsense	probably null
IGL01892:Tenm3	APN	8	48276396	missense	probably benign	0.09
IGL02098:Tenm3	APN	8	48276576	missense	possibly damaging	0.94
IGL02382:Tenm3	APN	8	48235476	missense	probably damaging	1.00
IGL02397:Tenm3	APN	8	48236694	missense	possibly damaging	0.94
IGL02475:Tenm3	APN	8	48279198	splice site	probably benign
IGL02502:Tenm3	APN	8	48288016	missense	probably damaging	1.00
IGL02508:Tenm3	APN	8	48299639	missense	probably benign	0.30
IGL02543:Tenm3	APN	8	48298956	missense	probably damaging	1.00
IGL02723:Tenm3	APN	8	48276903	missense	probably benign	0.02
IGL03037:Tenm3	APN	8	48298878	missense	possibly damaging	0.90
IGL03160:Tenm3	APN	8	48646418	missense	probably benign	0.05
IGL03268:Tenm3	APN	8	48235523	missense	probably damaging	1.00
IGL02988:Tenm3	UTSW	8	48235346	missense	probably damaging	0.99
PIT4431001:Tenm3	UTSW	8	48235607	missense	probably damaging	1.00
PIT4504001:Tenm3	UTSW	8	48293657	missense	probably damaging	1.00
R0079:Tenm3	UTSW	8	48343345	missense	possibly damaging	0.90
R0121:Tenm3	UTSW	8	48342659	missense	probably damaging	0.99
R0123:Tenm3	UTSW	8	48674472	missense	probably damaging	1.00
R0134:Tenm3	UTSW	8	48674472	missense	probably damaging	1.00
R0147:Tenm3	UTSW	8	48236720	missense	probably damaging	1.00
R0148:Tenm3	UTSW	8	48236720	missense	probably damaging	1.00
R0309:Tenm3	UTSW	8	48341034	missense	probably damaging	1.00
R0322:Tenm3	UTSW	8	48236912	splice site	probably benign
R0335:Tenm3	UTSW	8	48232105	missense	probably damaging	1.00
R0355:Tenm3	UTSW	8	48228975	missense	probably damaging	1.00
R0411:Tenm3	UTSW	8	48287791	missense	possibly damaging	0.61
R0505:Tenm3	UTSW	8	48341160	splice site	probably benign
R0573:Tenm3	UTSW	8	48674399	splice site	probably benign
R0599:Tenm3	UTSW	8	48277710	missense	probably damaging	1.00
R0616:Tenm3	UTSW	8	48276156	missense	possibly damaging	0.76
R0637:Tenm3	UTSW	8	48236525	missense	probably damaging	1.00
R0726:Tenm3	UTSW	8	48236594	missense	probably damaging	1.00
R0840:Tenm3	UTSW	8	48335742	missense	probably damaging	0.99
R0981:Tenm3	UTSW	8	48298965	missense	probably damaging	1.00
R1006:Tenm3	UTSW	8	48228542	missense	probably damaging	1.00
R1199:Tenm3	UTSW	8	48235582	missense	probably damaging	0.99
R1223:Tenm3	UTSW	8	48240396	missense	possibly damaging	0.72
R1240:Tenm3	UTSW	8	48287893	missense	possibly damaging	0.74
R1394:Tenm3	UTSW	8	48276400	missense	probably benign
R1455:Tenm3	UTSW	8	48279048	missense	possibly damaging	0.87
R1459:Tenm3	UTSW	8	48235971	missense	probably damaging	1.00
R1473:Tenm3	UTSW	8	48310625	missense	probably damaging	1.00
R1501:Tenm3	UTSW	8	48343316	missense	probably damaging	0.99
R1507:Tenm3	UTSW	8	48287822	missense	probably benign	0.01
R1522:Tenm3	UTSW	8	48395576	missense	probably damaging	1.00
R1524:Tenm3	UTSW	8	48228981	missense	possibly damaging	0.92
R1553:Tenm3	UTSW	8	48236421	missense	probably damaging	1.00
R1572:Tenm3	UTSW	8	48228993	missense	possibly damaging	0.94
R1583:Tenm3	UTSW	8	48279074	missense	probably benign	0.09
R1732:Tenm3	UTSW	8	48310634	missense	probably damaging	1.00
R1768:Tenm3	UTSW	8	48232104	missense	probably damaging	1.00
R1777:Tenm3	UTSW	8	48417179	missense	probably benign	0.05
R1793:Tenm3	UTSW	8	48674544	missense	probably damaging	0.98
R1801:Tenm3	UTSW	8	48276256	missense	probably benign	0.39
R1863:Tenm3	UTSW	8	48276346	missense	probably benign	0.20
R1898:Tenm3	UTSW	8	48310761	missense	probably damaging	1.00
R1971:Tenm3	UTSW	8	48236313	missense	probably damaging	1.00
R1972:Tenm3	UTSW	8	48228591	missense	probably damaging	1.00
R1996:Tenm3	UTSW	8	48228668	missense	probably damaging	1.00
R2061:Tenm3	UTSW	8	48342256	critical splice donor site	probably null
R2109:Tenm3	UTSW	8	48343349	missense	possibly damaging	0.94
R2124:Tenm3	UTSW	8	48417006	critical splice donor site	probably null
R2190:Tenm3	UTSW	8	48395544	missense	probably damaging	1.00
R2204:Tenm3	UTSW	8	48674550	missense	probably benign	0.17
R2233:Tenm3	UTSW	8	48276169	missense	probably benign	0.04
R2234:Tenm3	UTSW	8	48276169	missense	probably benign	0.04
R2235:Tenm3	UTSW	8	48276169	missense	probably benign	0.04
R2237:Tenm3	UTSW	8	48342337	missense	probably damaging	1.00
R2418:Tenm3	UTSW	8	48276658	missense	possibly damaging	0.87
R2419:Tenm3	UTSW	8	48276658	missense	possibly damaging	0.87
R2435:Tenm3	UTSW	8	48287953	missense	probably damaging	1.00
R2483:Tenm3	UTSW	8	48240270	missense	probably damaging	0.99
R3406:Tenm3	UTSW	8	48228555	missense	probably damaging	1.00
R3724:Tenm3	UTSW	8	48277746	missense	probably damaging	0.97
R4009:Tenm3	UTSW	8	48349223	missense	probably damaging	1.00
R4210:Tenm3	UTSW	8	48349404	missense	probably damaging	1.00
R4293:Tenm3	UTSW	8	48395658	missense	probably damaging	1.00
R4656:Tenm3	UTSW	8	48293726	missense	probably damaging	1.00
R4663:Tenm3	UTSW	8	48235970	missense	probably damaging	1.00
R4835:Tenm3	UTSW	8	48313236	critical splice donor site	probably null
R4851:Tenm3	UTSW	8	48310621	critical splice donor site	probably null
R4867:Tenm3	UTSW	8	48235821	missense	probably damaging	1.00
R4892:Tenm3	UTSW	8	48276861	missense	probably damaging	0.99
R4895:Tenm3	UTSW	8	48300971	missense	probably damaging	1.00
R4962:Tenm3	UTSW	8	48278961	nonsense	probably null
R4995:Tenm3	UTSW	8	48229137	missense	possibly damaging	0.87
R4996:Tenm3	UTSW	8	48235826	missense	probably damaging	0.97
R5091:Tenm3	UTSW	8	48342308	missense	probably benign	0.14
R5228:Tenm3	UTSW	8	48236355	missense	probably damaging	1.00
R5253:Tenm3	UTSW	8	48229198	missense	possibly damaging	0.92
R5260:Tenm3	UTSW	8	48236855	missense	probably damaging	1.00
R5363:Tenm3	UTSW	8	48287831	missense	possibly damaging	0.55
R5414:Tenm3	UTSW	8	48236355	missense	probably damaging	1.00
R5427:Tenm3	UTSW	8	48236564	missense	probably damaging	1.00
R5431:Tenm3	UTSW	8	48367377	nonsense	probably null
R5566:Tenm3	UTSW	8	48279006	missense	probably damaging	1.00
R5579:Tenm3	UTSW	8	48236764	missense	probably damaging	1.00
R5656:Tenm3	UTSW	8	48228762	missense	probably damaging	1.00
R5931:Tenm3	UTSW	8	48646498	missense	probably benign	0.00
R5959:Tenm3	UTSW	8	48646447	nonsense	probably null
R5965:Tenm3	UTSW	8	48228508	nonsense	probably null
R6062:Tenm3	UTSW	8	48343406	missense	possibly damaging	0.46
R6151:Tenm3	UTSW	8	48395573	missense	probably damaging	1.00
R6157:Tenm3	UTSW	8	48298808	missense	probably damaging	0.96
R6167:Tenm3	UTSW	8	48254622	missense	possibly damaging	0.46
R6217:Tenm3	UTSW	8	48293665	missense	probably damaging	0.99
R6233:Tenm3	UTSW	8	48417059	missense	probably damaging	1.00
R6270:Tenm3	UTSW	8	48367394	missense	probably damaging	0.98
R6329:Tenm3	UTSW	8	48276849	missense	probably damaging	0.99
R6466:Tenm3	UTSW	8	48236063	missense	probably damaging	0.97
R6515:Tenm3	UTSW	8	48417222	missense	probably benign
R6516:Tenm3	UTSW	8	48417222	missense	probably benign
R6747:Tenm3	UTSW	8	48343243	missense	probably damaging	1.00
R6782:Tenm3	UTSW	8	48646256	critical splice donor site	probably null
R6788:Tenm3	UTSW	8	48674493	missense	probably damaging	1.00
R6823:Tenm3	UTSW	8	48256837	missense	probably damaging	0.99
R6846:Tenm3	UTSW	8	48276738	missense	probably benign	0.39
R6913:Tenm3	UTSW	8	48298937	missense	probably damaging	0.99
R6941:Tenm3	UTSW	8	48674416	missense	probably damaging	0.99
R6950:Tenm3	UTSW	8	48240479	nonsense	probably null
R6968:Tenm3	UTSW	8	48236439	missense	probably damaging	1.00
R6970:Tenm3	UTSW	8	48236439	missense	probably damaging	1.00
R6993:Tenm3	UTSW	8	48236439	missense	probably damaging	1.00
R7003:Tenm3	UTSW	8	48240444	missense	probably damaging	1.00
R7125:Tenm3	UTSW	8	48674553	missense	probably benign	0.00
R7140:Tenm3	UTSW	8	48292236	missense	probably damaging	1.00
R7222:Tenm3	UTSW	8	48300969	missense	probably damaging	1.00
R7232:Tenm3	UTSW	8	48235935	missense	probably damaging	1.00
R7336:Tenm3	UTSW	8	48236177	missense	possibly damaging	0.93
R7417:Tenm3	UTSW	8	48236183	missense	probably damaging	1.00
R7526:Tenm3	UTSW	8	48287812	missense	probably damaging	0.96
R7527:Tenm3	UTSW	8	48276600	missense	possibly damaging	0.60
R7616:Tenm3	UTSW	8	48341049	missense	possibly damaging	0.56
R7662:Tenm3	UTSW	8	48335727	missense	probably benign	0.27
R7734:Tenm3	UTSW	8	48646333	missense	probably damaging	1.00
R7802:Tenm3	UTSW	8	48236465	missense	probably damaging	1.00
R7812:Tenm3	UTSW	8	48276300	missense	probably benign	0.01
R7843:Tenm3	UTSW	8	48229111	nonsense	probably null
R7951:Tenm3	UTSW	8	48310703	missense	possibly damaging	0.86
R8293:Tenm3	UTSW	8	48367422	missense	possibly damaging	0.91
R8336:Tenm3	UTSW	8	48293773	missense	probably damaging	1.00
R8351:Tenm3	UTSW	8	48287872	missense	probably damaging	0.96
R8387:Tenm3	UTSW	8	48287848	missense	probably damaging	0.98
R8414:Tenm3	UTSW	8	48293509	missense	probably damaging	1.00
R8451:Tenm3	UTSW	8	48287872	missense	probably damaging	0.96
R8465:Tenm3	UTSW	8	48229181	missense	probably damaging	1.00
R8528:Tenm3	UTSW	8	48342633	missense	probably damaging	1.00
R8717:Tenm3	UTSW	8	48299645	missense	possibly damaging	0.77
R8734:Tenm3	UTSW	8	48349356	missense	probably benign	0.16
R8781:Tenm3	UTSW	8	48342449	frame shift	probably null
R8820:Tenm3	UTSW	8	48310724	missense	probably damaging	0.96
R8821:Tenm3	UTSW	8	48276382	missense
R8831:Tenm3	UTSW	8	48276382	missense
R8853:Tenm3	UTSW	8	48342347	missense	probably damaging	1.00
R8900:Tenm3	UTSW	8	48236402	missense	probably damaging	1.00
R8931:Tenm3	UTSW	8	48235602	missense	probably damaging	1.00
R8933:Tenm3	UTSW	8	48279060	missense	possibly damaging	0.53
R8989:Tenm3	UTSW	8	48235348	nonsense	probably null
R8998:Tenm3	UTSW	8	48276687	missense	probably damaging	1.00
R9008:Tenm3	UTSW	8	48342653	missense	probably damaging	0.98
R9017:Tenm3	UTSW	8	48254633	missense	probably damaging	0.99
R9101:Tenm3	UTSW	8	48292151	missense	probably damaging	1.00
R9108:Tenm3	UTSW	8	48313236	critical splice donor site	probably null
R9142:Tenm3	UTSW	8	48335513	missense	unknown
R9231:Tenm3	UTSW	8	48236196	missense	probably damaging	1.00
R9309:Tenm3	UTSW	8	48298937	missense	probably damaging	0.99
R9310:Tenm3	UTSW	8	48555900	unclassified	probably benign
R9336:Tenm3	UTSW	8	48417080	missense	probably damaging	1.00
R9373:Tenm3	UTSW	8	48299655	missense	probably damaging	1.00
R9393:Tenm3	UTSW	8	48674524	missense	probably damaging	0.99
R9509:Tenm3	UTSW	8	48313257	nonsense	probably null
R9575:Tenm3	UTSW	8	48235761	missense	possibly damaging	0.94
R9698:Tenm3	UTSW	8	48236211	missense	probably damaging	1.00
R9722:Tenm3	UTSW	8	48300814	missense	probably benign	0.00
R9788:Tenm3	UTSW	8	48335561	missense	probably benign	0.02
X0010:Tenm3	UTSW	8	48287829	missense	probably damaging	0.98
X0025:Tenm3	UTSW	8	48236477	missense	probably damaging	1.00
Z1177:Tenm3	UTSW	8	48276780	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGGCGTCAAAATGTGCCCCGTTG -3'
(R):5'- TGCGGATGCACCTACATACACACAG -3'

Sequencing Primer
(F):5'- CGTTGTAAATCGTAGCAGCC -3'
(R):5'- GATGCACCTACATACACACAGAAATG -3'

Posted On

2014-05-09