Incidental Mutation 'R1676:Ncam1'
ID188090
Institutional Source Beutler Lab
Gene Symbol Ncam1
Ensembl Gene ENSMUSG00000039542
Gene Nameneural cell adhesion molecule 1
SynonymsNCAM-140, E-NCAM, NCAM-180, NCAM-1, CD56, NCAM-120, NCAM
MMRRC Submission 039712-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.892) question?
Stock #R1676 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location49502136-49798925 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 49557172 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 329 (T329I)
Ref Sequence ENSEMBL: ENSMUSP00000141700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114476] [ENSMUST00000166811] [ENSMUST00000192584] [ENSMUST00000193547]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000068730
Predicted Effect possibly damaging
Transcript: ENSMUST00000114476
AA Change: T329I

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110120
Gene: ENSMUSG00000039542
AA Change: T329I

DomainStartEndE-ValueType
IGc2 32 103 2.88e-4 SMART
IGc2 130 196 6.35e-6 SMART
IGc2 226 295 6.38e-20 SMART
IGc2 321 393 4.12e-14 SMART
IGc2 418 487 9.7e-11 SMART
FN3 501 586 4.77e-8 SMART
FN3 602 683 6.97e-1 SMART
low complexity region 711 725 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000166811
AA Change: T329I
SMART Domains Protein: ENSMUSP00000130668
Gene: ENSMUSG00000039542
AA Change: T329I

DomainStartEndE-ValueType
IGc2 32 103 2.88e-4 SMART
IGc2 130 196 6.35e-6 SMART
IGc2 226 295 6.38e-20 SMART
IGc2 321 393 4.12e-14 SMART
IGc2 418 487 9.7e-11 SMART
FN3 501 586 4.77e-8 SMART
FN3 602 683 6.97e-1 SMART
transmembrane domain 706 728 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
low complexity region 814 830 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192584
AA Change: T329I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141700
Gene: ENSMUSG00000039542
AA Change: T329I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 32 103 1.2e-6 SMART
IGc2 130 196 2.6e-8 SMART
IGc2 226 295 2.6e-22 SMART
IGc2 321 393 1.6e-16 SMART
IGc2 418 487 4e-13 SMART
FN3 501 586 2.4e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000193547
AA Change: T329I

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142275
Gene: ENSMUSG00000039542
AA Change: T329I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 32 103 2.88e-4 SMART
IGc2 130 196 6.35e-6 SMART
IGc2 226 295 6.38e-20 SMART
IGc2 321 393 4.12e-14 SMART
IGc2 418 487 9.7e-11 SMART
FN3 501 586 4.77e-8 SMART
FN3 602 683 6.97e-1 SMART
transmembrane domain 706 728 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
low complexity region 814 830 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000194252
AA Change: T286I
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215070
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215465
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216483
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell adhesion protein which is a member of the immunoglobulin superfamily. The encoded protein is involved in cell-to-cell interactions as well as cell-matrix interactions during development and differentiation. The encoded protein has been shown to be involved in development of the nervous system, and for cells involved in the expansion of T cells and dendritic cells which play an important role in immune surveillance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous mutants show impairment in Morris water maze test, reduced brain and olfactory bulb size, hypoplasic corticospinal tract, abnormally distributed anterior pituitary cell types, and morphological and functional defects of neuromuscular junctions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik G T 11: 58,880,993 A434S possibly damaging Het
Abhd8 T A 8: 71,461,873 D37V probably damaging Het
Acvr2a G A 2: 48,873,083 S97N probably benign Het
Ampd3 T A 7: 110,795,733 H296Q probably damaging Het
Arid4a G A 12: 71,075,338 S509N probably benign Het
Cap2 T G 13: 46,637,859 H167Q probably damaging Het
Car8 A G 4: 8,185,616 L180S probably damaging Het
Casp8 T A 1: 58,844,416 I314N probably damaging Het
Cavin2 T A 1: 51,301,171 S336T probably benign Het
Cdc14b A T 13: 64,225,602 I119N possibly damaging Het
Cemip T A 7: 83,964,038 I651F possibly damaging Het
Cfap57 T A 4: 118,595,940 D522V probably damaging Het
Clrn3 A T 7: 135,518,578 V93D probably damaging Het
Cyp4f39 A G 17: 32,482,202 D222G probably benign Het
D5Ertd579e A G 5: 36,616,109 V314A probably benign Het
Dchs1 C T 7: 105,754,921 V2805I probably benign Het
Dsp A T 13: 38,193,374 K1712* probably null Het
Emilin2 T C 17: 71,274,090 D547G probably benign Het
Erbb3 T C 10: 128,583,248 H248R probably benign Het
Erich3 A G 3: 154,762,623 probably benign Het
Fam213b C T 4: 154,897,063 V186I probably benign Het
Fbn1 T C 2: 125,309,781 T2518A probably damaging Het
Fzd2 G A 11: 102,605,881 V384M probably damaging Het
Gm14085 T C 2: 122,521,859 S366P probably damaging Het
Gpc5 T A 14: 115,370,098 S371T probably damaging Het
Hbb-bh2 T C 7: 103,839,155 K145R probably null Het
Hectd1 G T 12: 51,744,788 P2558Q probably damaging Het
Hgsnat C T 8: 25,954,605 probably null Het
Hirip3 T C 7: 126,863,475 probably null Het
Ispd T C 12: 36,476,721 C170R probably benign Het
Itpkc T C 7: 27,208,281 D666G probably damaging Het
Jmjd1c T A 10: 67,224,809 D693E probably benign Het
Katnbl1 T C 2: 112,406,109 L60P probably damaging Het
Kcna1 T A 6: 126,642,682 E225V probably damaging Het
Kcnj6 T A 16: 94,832,584 M223L probably damaging Het
Kcnk7 G T 19: 5,706,978 V332F probably benign Het
Kmt5a GAA GA 5: 124,459,885 probably null Het
Mdga2 C A 12: 66,568,772 G618V probably damaging Het
Mdga2 C A 12: 66,568,773 G618* probably null Het
Morc2b T C 17: 33,135,981 E939G possibly damaging Het
Mstn T A 1: 53,062,065 D100E probably benign Het
Mthfd1l G A 10: 4,083,877 probably null Het
Muc20 T A 16: 32,794,279 T243S probably damaging Het
Myo1d A T 11: 80,684,421 N156K probably damaging Het
Myo7a A G 7: 98,099,472 probably null Het
Naa35 A T 13: 59,612,676 Q274L probably damaging Het
Nisch T C 14: 31,180,902 probably benign Het
Nlrp1b A T 11: 71,182,811 W69R probably benign Het
Nrap T A 19: 56,335,255 H1294L probably damaging Het
Nsun6 T A 2: 15,047,213 R56* probably null Het
Nudt1 A G 5: 140,334,623 probably null Het
Nxph4 T G 10: 127,526,208 K271N probably damaging Het
Olfr1196 T G 2: 88,701,317 H4P probably benign Het
Olfr243 T C 7: 103,717,112 W173R probably benign Het
Olfr366 A T 2: 37,219,641 R51* probably null Het
Olfr78 T A 7: 102,742,398 I202F probably damaging Het
Otud6b T A 4: 14,825,617 N71I probably damaging Het
Parp8 T A 13: 116,877,528 D623V probably damaging Het
Pcdhb5 T C 18: 37,320,752 S62P probably benign Het
Ppp1r12b A G 1: 134,777,452 S833P probably damaging Het
Ppp1r1a T G 15: 103,533,488 D51A probably damaging Het
Prag1 C A 8: 36,102,898 P212T probably damaging Het
Ptdss1 A G 13: 66,933,637 T44A probably damaging Het
Rab14 T C 2: 35,186,723 H83R possibly damaging Het
Rapgef3 C T 15: 97,761,182 G101E probably benign Het
Rimbp3 T A 16: 17,211,113 D800E probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Selenbp1 A G 3: 94,944,543 D465G probably damaging Het
Slc29a1 T C 17: 45,589,010 D251G probably damaging Het
Slc6a11 G T 6: 114,247,666 V604F probably benign Het
Sltm T A 9: 70,573,647 D260E probably damaging Het
Spta1 G A 1: 174,179,839 V212M probably damaging Het
St6gal2 T C 17: 55,496,395 probably null Het
Tc2n A G 12: 101,688,992 S235P probably damaging Het
Tenm3 T A 8: 48,417,119 N213I possibly damaging Het
Ticam2 T C 18: 46,560,610 T137A probably damaging Het
Ttn TCCC TCCCC 2: 76,742,907 probably null Het
Tyk2 G A 9: 21,115,249 Q684* probably null Het
Ubqln1 A G 13: 58,179,391 F478S possibly damaging Het
Uckl1 G A 2: 181,574,918 T78I probably damaging Het
Uhmk1 A G 1: 170,200,012 V372A probably damaging Het
Unc5c G A 3: 141,757,837 V240I possibly damaging Het
Ush2a T C 1: 188,728,585 L2681P probably damaging Het
Vmn2r1 C T 3: 64,090,182 Q420* probably null Het
Vmn2r101 A T 17: 19,611,922 T727S probably benign Het
Vmn2r79 A G 7: 87,002,631 T413A probably benign Het
Vps13c T C 9: 67,926,962 V1637A probably benign Het
Xpc A G 6: 91,492,947 V765A possibly damaging Het
Zbtb18 T G 1: 177,447,347 probably null Het
Zfp712 A T 13: 67,052,336 D28E probably benign Het
Zfp735 A G 11: 73,711,475 N415S possibly damaging Het
Other mutations in Ncam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Ncam1 APN 9 49523565 missense probably damaging 1.00
IGL01384:Ncam1 APN 9 49509852 missense possibly damaging 0.76
IGL01798:Ncam1 APN 9 49508607 missense probably damaging 1.00
IGL02239:Ncam1 APN 9 49567402 missense probably damaging 1.00
IGL02368:Ncam1 APN 9 49543083 nonsense probably null
IGL02616:Ncam1 APN 9 49508688 missense probably benign 0.23
PIT4431001:Ncam1 UTSW 9 49798693 missense probably benign 0.04
R0164:Ncam1 UTSW 9 49568409 missense probably damaging 1.00
R0164:Ncam1 UTSW 9 49568409 missense probably damaging 1.00
R0502:Ncam1 UTSW 9 49569818 unclassified probably benign
R0924:Ncam1 UTSW 9 49562176 intron probably benign
R1398:Ncam1 UTSW 9 49517589 intron probably benign
R1440:Ncam1 UTSW 9 49544800 missense probably damaging 1.00
R1491:Ncam1 UTSW 9 49505549 missense probably benign 0.15
R1743:Ncam1 UTSW 9 49557145 missense probably damaging 1.00
R1769:Ncam1 UTSW 9 49545256 unclassified probably benign
R1951:Ncam1 UTSW 9 49545192 missense probably benign 0.36
R2143:Ncam1 UTSW 9 49543019 missense possibly damaging 0.87
R2167:Ncam1 UTSW 9 49568481 missense probably benign 0.42
R2170:Ncam1 UTSW 9 49798681 missense probably benign 0.06
R2290:Ncam1 UTSW 9 49523651 splice site probably benign
R2321:Ncam1 UTSW 9 49544832 unclassified probably benign
R3001:Ncam1 UTSW 9 49557226 missense probably damaging 0.99
R3002:Ncam1 UTSW 9 49557226 missense probably damaging 0.99
R4026:Ncam1 UTSW 9 49564995 missense probably benign 0.00
R4279:Ncam1 UTSW 9 49506959 intron probably benign
R4289:Ncam1 UTSW 9 49557172 missense probably damaging 1.00
R4873:Ncam1 UTSW 9 49507621 intron probably benign
R4875:Ncam1 UTSW 9 49507621 intron probably benign
R4883:Ncam1 UTSW 9 49541883 splice site probably null
R4899:Ncam1 UTSW 9 49545251 critical splice acceptor site probably null
R4923:Ncam1 UTSW 9 49505479 missense probably benign
R5041:Ncam1 UTSW 9 49566785 missense probably damaging 1.00
R5058:Ncam1 UTSW 9 49798695 missense probably benign 0.16
R5386:Ncam1 UTSW 9 49564874 missense probably damaging 1.00
R5388:Ncam1 UTSW 9 49544754 missense probably benign
R5512:Ncam1 UTSW 9 49509699 splice site probably null
R5598:Ncam1 UTSW 9 49545751 missense probably damaging 1.00
R5895:Ncam1 UTSW 9 49507043 missense probably benign
R5972:Ncam1 UTSW 9 49507529 missense possibly damaging 0.93
R6059:Ncam1 UTSW 9 49544666 missense probably damaging 1.00
R6226:Ncam1 UTSW 9 49565004 missense probably benign 0.00
R6392:Ncam1 UTSW 9 49523575 missense probably damaging 0.99
R6750:Ncam1 UTSW 9 49567339 missense probably damaging 1.00
R6799:Ncam1 UTSW 9 49508611 missense probably damaging 0.99
R7230:Ncam1 UTSW 9 49509823 missense probably benign 0.00
R7335:Ncam1 UTSW 9 49506911 missense
R7561:Ncam1 UTSW 9 49564942 missense probably damaging 1.00
R7645:Ncam1 UTSW 9 49565003 missense probably benign 0.01
X0062:Ncam1 UTSW 9 49545601 nonsense probably null
X0064:Ncam1 UTSW 9 49566680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGAGTAAACCACAACCAGGCAGG -3'
(R):5'- TTGTCAGAATGCGTGGGAGTACAAG -3'

Sequencing Primer
(F):5'- ACTGGTGACCCCCATCC -3'
(R):5'- GGAGTACAAGTCTGTGTCTCCTAC -3'
Posted On2014-05-09