Incidental Mutation 'R1676:Nlrp1b'
ID188099
Institutional Source Beutler Lab
Gene Symbol Nlrp1b
Ensembl Gene ENSMUSG00000070390
Gene NameNLR family, pyrin domain containing 1B
SynonymsNalp1b
MMRRC Submission 039712-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R1676 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location71153102-71230733 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 71182811 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 69 (W69R)
Ref Sequence ENSEMBL: ENSMUSP00000104155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094046] [ENSMUST00000108514] [ENSMUST00000108515] [ENSMUST00000108516] [ENSMUST00000136493]
Predicted Effect probably benign
Transcript: ENSMUST00000094046
SMART Domains Protein: ENSMUSP00000091588
Gene: ENSMUSG00000070390

DomainStartEndE-ValueType
Pfam:NACHT 131 300 6.7e-43 PFAM
LRR 627 654 2.24e0 SMART
LRR 656 683 8.82e0 SMART
LRR 684 711 3.49e-5 SMART
Pfam:FIIND 812 1064 8.2e-104 PFAM
Pfam:CARD 1083 1166 3.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108514
AA Change: W69R

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000104154
Gene: ENSMUSG00000070390
AA Change: W69R

DomainStartEndE-ValueType
Pfam:NACHT 131 300 2.1e-40 PFAM
LRR 630 657 2.24e0 SMART
LRR 659 686 8.82e0 SMART
LRR 687 714 3.49e-5 SMART
Pfam:FIIND 814 1068 2.4e-136 PFAM
Pfam:CARD 1086 1169 3.7e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108515
AA Change: W69R

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000104155
Gene: ENSMUSG00000070390
AA Change: W69R

DomainStartEndE-ValueType
Pfam:NACHT 131 300 6.9e-41 PFAM
LRR 630 657 2.24e0 SMART
LRR 659 686 8.82e0 SMART
LRR 687 714 3.49e-5 SMART
Pfam:FIIND 815 1067 5e-104 PFAM
Pfam:CARD 1086 1169 1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108516
SMART Domains Protein: ENSMUSP00000104156
Gene: ENSMUSG00000070390

DomainStartEndE-ValueType
Pfam:NACHT 131 300 2.2e-42 PFAM
LRR 627 654 2.24e0 SMART
LRR 656 683 8.82e0 SMART
LRR 684 711 3.49e-5 SMART
Pfam:FIIND 811 1065 3.9e-136 PFAM
Pfam:CARD 1083 1166 1.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136493
SMART Domains Protein: ENSMUSP00000121155
Gene: ENSMUSG00000070390

DomainStartEndE-ValueType
Pfam:NACHT 131 300 8.9e-43 PFAM
PDB:4IM6|A 610 662 6e-10 PDB
Blast:LRR 627 654 3e-11 BLAST
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ced-4 family of apoptosis proteins. Ced-family members contain a caspase recruitment domain (CARD) and are known to be key mediators of programmed cell death. The encoded protein contains a distinct N-terminal pyrin-like motif, which is possibly involved in protein-protein interactions. This protein interacts strongly with caspase 2 and weakly with caspase 9. Overexpression of this gene was demonstrated to induce apoptosis in cells. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit protection from anthrax lethal toxin-induced lung injury and pyroptosis of macrophages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik G T 11: 58,880,993 A434S possibly damaging Het
Abhd8 T A 8: 71,461,873 D37V probably damaging Het
Acvr2a G A 2: 48,873,083 S97N probably benign Het
Ampd3 T A 7: 110,795,733 H296Q probably damaging Het
Arid4a G A 12: 71,075,338 S509N probably benign Het
Cap2 T G 13: 46,637,859 H167Q probably damaging Het
Car8 A G 4: 8,185,616 L180S probably damaging Het
Casp8 T A 1: 58,844,416 I314N probably damaging Het
Cavin2 T A 1: 51,301,171 S336T probably benign Het
Cdc14b A T 13: 64,225,602 I119N possibly damaging Het
Cemip T A 7: 83,964,038 I651F possibly damaging Het
Cfap57 T A 4: 118,595,940 D522V probably damaging Het
Clrn3 A T 7: 135,518,578 V93D probably damaging Het
Cyp4f39 A G 17: 32,482,202 D222G probably benign Het
D5Ertd579e A G 5: 36,616,109 V314A probably benign Het
Dchs1 C T 7: 105,754,921 V2805I probably benign Het
Dsp A T 13: 38,193,374 K1712* probably null Het
Emilin2 T C 17: 71,274,090 D547G probably benign Het
Erbb3 T C 10: 128,583,248 H248R probably benign Het
Erich3 A G 3: 154,762,623 probably benign Het
Fam213b C T 4: 154,897,063 V186I probably benign Het
Fbn1 T C 2: 125,309,781 T2518A probably damaging Het
Fzd2 G A 11: 102,605,881 V384M probably damaging Het
Gm14085 T C 2: 122,521,859 S366P probably damaging Het
Gpc5 T A 14: 115,370,098 S371T probably damaging Het
Hbb-bh2 T C 7: 103,839,155 K145R probably null Het
Hectd1 G T 12: 51,744,788 P2558Q probably damaging Het
Hgsnat C T 8: 25,954,605 probably null Het
Hirip3 T C 7: 126,863,475 probably null Het
Ispd T C 12: 36,476,721 C170R probably benign Het
Itpkc T C 7: 27,208,281 D666G probably damaging Het
Jmjd1c T A 10: 67,224,809 D693E probably benign Het
Katnbl1 T C 2: 112,406,109 L60P probably damaging Het
Kcna1 T A 6: 126,642,682 E225V probably damaging Het
Kcnj6 T A 16: 94,832,584 M223L probably damaging Het
Kcnk7 G T 19: 5,706,978 V332F probably benign Het
Kmt5a GAA GA 5: 124,459,885 probably null Het
Mdga2 C A 12: 66,568,772 G618V probably damaging Het
Mdga2 C A 12: 66,568,773 G618* probably null Het
Morc2b T C 17: 33,135,981 E939G possibly damaging Het
Mstn T A 1: 53,062,065 D100E probably benign Het
Mthfd1l G A 10: 4,083,877 probably null Het
Muc20 T A 16: 32,794,279 T243S probably damaging Het
Myo1d A T 11: 80,684,421 N156K probably damaging Het
Myo7a A G 7: 98,099,472 probably null Het
Naa35 A T 13: 59,612,676 Q274L probably damaging Het
Ncam1 G A 9: 49,557,172 T329I probably damaging Het
Nisch T C 14: 31,180,902 probably benign Het
Nrap T A 19: 56,335,255 H1294L probably damaging Het
Nsun6 T A 2: 15,047,213 R56* probably null Het
Nudt1 A G 5: 140,334,623 probably null Het
Nxph4 T G 10: 127,526,208 K271N probably damaging Het
Olfr1196 T G 2: 88,701,317 H4P probably benign Het
Olfr243 T C 7: 103,717,112 W173R probably benign Het
Olfr366 A T 2: 37,219,641 R51* probably null Het
Olfr78 T A 7: 102,742,398 I202F probably damaging Het
Otud6b T A 4: 14,825,617 N71I probably damaging Het
Parp8 T A 13: 116,877,528 D623V probably damaging Het
Pcdhb5 T C 18: 37,320,752 S62P probably benign Het
Ppp1r12b A G 1: 134,777,452 S833P probably damaging Het
Ppp1r1a T G 15: 103,533,488 D51A probably damaging Het
Prag1 C A 8: 36,102,898 P212T probably damaging Het
Ptdss1 A G 13: 66,933,637 T44A probably damaging Het
Rab14 T C 2: 35,186,723 H83R possibly damaging Het
Rapgef3 C T 15: 97,761,182 G101E probably benign Het
Rimbp3 T A 16: 17,211,113 D800E probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Selenbp1 A G 3: 94,944,543 D465G probably damaging Het
Slc29a1 T C 17: 45,589,010 D251G probably damaging Het
Slc6a11 G T 6: 114,247,666 V604F probably benign Het
Sltm T A 9: 70,573,647 D260E probably damaging Het
Spta1 G A 1: 174,179,839 V212M probably damaging Het
St6gal2 T C 17: 55,496,395 probably null Het
Tc2n A G 12: 101,688,992 S235P probably damaging Het
Tenm3 T A 8: 48,417,119 N213I possibly damaging Het
Ticam2 T C 18: 46,560,610 T137A probably damaging Het
Ttn TCCC TCCCC 2: 76,742,907 probably null Het
Tyk2 G A 9: 21,115,249 Q684* probably null Het
Ubqln1 A G 13: 58,179,391 F478S possibly damaging Het
Uckl1 G A 2: 181,574,918 T78I probably damaging Het
Uhmk1 A G 1: 170,200,012 V372A probably damaging Het
Unc5c G A 3: 141,757,837 V240I possibly damaging Het
Ush2a T C 1: 188,728,585 L2681P probably damaging Het
Vmn2r1 C T 3: 64,090,182 Q420* probably null Het
Vmn2r101 A T 17: 19,611,922 T727S probably benign Het
Vmn2r79 A G 7: 87,002,631 T413A probably benign Het
Vps13c T C 9: 67,926,962 V1637A probably benign Het
Xpc A G 6: 91,492,947 V765A possibly damaging Het
Zbtb18 T G 1: 177,447,347 probably null Het
Zfp712 A T 13: 67,052,336 D28E probably benign Het
Zfp735 A G 11: 73,711,475 N415S possibly damaging Het
Other mutations in Nlrp1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Nlrp1b APN 11 71181181 intron probably benign
IGL00571:Nlrp1b APN 11 71163973 missense probably null 0.48
IGL01358:Nlrp1b APN 11 71181856 missense possibly damaging 0.91
IGL01937:Nlrp1b APN 11 71181407 missense probably damaging 0.98
IGL01945:Nlrp1b APN 11 71181407 missense probably damaging 0.98
IGL02375:Nlrp1b APN 11 71161680 missense probably damaging 1.00
IGL02552:Nlrp1b APN 11 71182052 missense possibly damaging 0.57
IGL02552:Nlrp1b APN 11 71172231 missense possibly damaging 0.96
IGL02588:Nlrp1b APN 11 71182279 nonsense probably null
IGL02833:Nlrp1b APN 11 71161172 missense probably benign
IGL02955:Nlrp1b APN 11 71169811 missense possibly damaging 0.73
IGL03002:Nlrp1b APN 11 71168859 missense probably benign 0.00
IGL03033:Nlrp1b APN 11 71161839 missense probably benign 0.22
IGL03122:Nlrp1b APN 11 71181833 missense probably benign 0.00
IGL03131:Nlrp1b APN 11 71161915 missense possibly damaging 0.82
androcles UTSW 11 71172075 nonsense probably null
Fangled UTSW 11 71172171 missense possibly damaging 0.94
glitz UTSW 11 71181550 missense possibly damaging 0.89
honeydew UTSW 11 71217884 missense possibly damaging 0.93
Mush UTSW 11 71156079 missense probably damaging 1.00
R0001:Nlrp1b UTSW 11 71161759 missense probably damaging 1.00
R0022:Nlrp1b UTSW 11 71161929 missense possibly damaging 0.61
R0022:Nlrp1b UTSW 11 71161929 missense possibly damaging 0.61
R0038:Nlrp1b UTSW 11 71172171 missense possibly damaging 0.94
R0038:Nlrp1b UTSW 11 71172171 missense possibly damaging 0.94
R0164:Nlrp1b UTSW 11 71164099 missense probably damaging 1.00
R0164:Nlrp1b UTSW 11 71164099 missense probably damaging 1.00
R0271:Nlrp1b UTSW 11 71161765 missense possibly damaging 0.51
R0464:Nlrp1b UTSW 11 71218244 missense probably damaging 1.00
R0504:Nlrp1b UTSW 11 71182415 missense probably damaging 0.99
R0605:Nlrp1b UTSW 11 71156179 missense possibly damaging 0.88
R0863:Nlrp1b UTSW 11 71181347 missense probably benign 0.00
R1075:Nlrp1b UTSW 11 71181686 missense probably benign 0.35
R1221:Nlrp1b UTSW 11 71181464 missense probably benign 0.07
R1501:Nlrp1b UTSW 11 71156059 missense probably damaging 1.00
R1654:Nlrp1b UTSW 11 71181298 missense probably damaging 0.99
R1671:Nlrp1b UTSW 11 71201259 missense probably benign 0.45
R1694:Nlrp1b UTSW 11 71216855 critical splice donor site probably null
R1709:Nlrp1b UTSW 11 71201273 missense probably benign 0.11
R1770:Nlrp1b UTSW 11 71160153 missense probably benign 0.22
R1775:Nlrp1b UTSW 11 71161821 missense probably damaging 1.00
R1851:Nlrp1b UTSW 11 71182616 missense possibly damaging 0.96
R1932:Nlrp1b UTSW 11 71182138 missense probably damaging 0.96
R2063:Nlrp1b UTSW 11 71161086 missense probably benign 0.09
R2189:Nlrp1b UTSW 11 71169795 missense probably damaging 1.00
R2223:Nlrp1b UTSW 11 71155989 splice site probably benign
R2284:Nlrp1b UTSW 11 71156284 missense probably benign 0.00
R2434:Nlrp1b UTSW 11 71156726 splice site probably null
R3079:Nlrp1b UTSW 11 71217968 missense probably benign 0.27
R3775:Nlrp1b UTSW 11 71156300 splice site probably benign
R3980:Nlrp1b UTSW 11 71181611 missense possibly damaging 0.56
R4016:Nlrp1b UTSW 11 71173085 missense probably damaging 1.00
R4085:Nlrp1b UTSW 11 71161762 missense probably damaging 0.98
R4542:Nlrp1b UTSW 11 71228325 missense probably damaging 1.00
R4623:Nlrp1b UTSW 11 71161843 missense probably benign 0.00
R4726:Nlrp1b UTSW 11 71181406 missense probably benign 0.10
R4764:Nlrp1b UTSW 11 71182663 missense probably damaging 1.00
R4885:Nlrp1b UTSW 11 71217884 missense possibly damaging 0.93
R4910:Nlrp1b UTSW 11 71217277 missense probably benign 0.09
R4997:Nlrp1b UTSW 11 71218334 missense probably damaging 1.00
R5046:Nlrp1b UTSW 11 71160072 missense possibly damaging 0.95
R5126:Nlrp1b UTSW 11 71181533 missense possibly damaging 0.67
R5369:Nlrp1b UTSW 11 71181799 missense probably benign
R5388:Nlrp1b UTSW 11 71172141 missense probably damaging 1.00
R5445:Nlrp1b UTSW 11 71217875 missense probably benign 0.21
R5546:Nlrp1b UTSW 11 71217276 missense probably benign 0.04
R5567:Nlrp1b UTSW 11 71181403 missense probably benign
R5826:Nlrp1b UTSW 11 71181196 missense probably benign 0.17
R5955:Nlrp1b UTSW 11 71217865 missense probably damaging 1.00
R5995:Nlrp1b UTSW 11 71181746 missense probably damaging 1.00
R6059:Nlrp1b UTSW 11 71217010 missense possibly damaging 0.53
R6170:Nlrp1b UTSW 11 71156079 missense probably damaging 1.00
R6191:Nlrp1b UTSW 11 71218457 nonsense probably null
R6250:Nlrp1b UTSW 11 71181799 missense probably benign 0.11
R6312:Nlrp1b UTSW 11 71228397 missense probably benign 0.38
R6352:Nlrp1b UTSW 11 71181701 missense probably damaging 0.99
R6807:Nlrp1b UTSW 11 71217704 missense probably damaging 1.00
R6854:Nlrp1b UTSW 11 71228433 missense possibly damaging 0.93
R6908:Nlrp1b UTSW 11 71217296 missense probably benign
R6938:Nlrp1b UTSW 11 71218216 missense probably damaging 1.00
R7098:Nlrp1b UTSW 11 71218274 missense possibly damaging 0.89
R7142:Nlrp1b UTSW 11 71172075 nonsense probably null
R7149:Nlrp1b UTSW 11 71181656 nonsense probably null
R7349:Nlrp1b UTSW 11 71182117 missense probably benign 0.36
R7354:Nlrp1b UTSW 11 71181550 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TTGACTTCCCAATCCCAGCAGC -3'
(R):5'- GCCTAGACAGATGCCTAAATGCATCC -3'

Sequencing Primer
(F):5'- AATTGAGGCTCTTTCTGAGTACC -3'
(R):5'- aggaagggagggaagaagg -3'
Posted On2014-05-09