Incidental Mutation 'R1676:Ptdss1'
ID188114
Institutional Source Beutler Lab
Gene Symbol Ptdss1
Ensembl Gene ENSMUSG00000021518
Gene Namephosphatidylserine synthase 1
SynonymsPSS-1, PtdSer Synthase-1
MMRRC Submission 039712-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1676 (G1)
Quality Score197
Status Not validated
Chromosome13
Chromosomal Location66932830-66998401 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 66933637 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 44 (T44A)
Ref Sequence ENSEMBL: ENSMUSP00000153610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021990] [ENSMUST00000021991] [ENSMUST00000172597] [ENSMUST00000173158] [ENSMUST00000173407] [ENSMUST00000173773] [ENSMUST00000173910] [ENSMUST00000174339] [ENSMUST00000224085] [ENSMUST00000224244] [ENSMUST00000224290]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021990
AA Change: T44A

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000021990
Gene: ENSMUSG00000021518
AA Change: T44A

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 72 89 N/A INTRINSIC
Pfam:PSS 96 372 1.3e-108 PFAM
transmembrane domain 383 405 N/A INTRINSIC
low complexity region 442 464 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000021991
SMART Domains Protein: ENSMUSP00000021991
Gene: ENSMUSG00000021519

DomainStartEndE-ValueType
low complexity region 97 117 N/A INTRINSIC
Mterf 161 196 1.63e3 SMART
Mterf 201 231 7.37e-1 SMART
Mterf 236 267 4.68e-3 SMART
Mterf 272 303 2.12e-1 SMART
Mterf 308 339 4.11e1 SMART
Mterf 340 370 9.22e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172597
SMART Domains Protein: ENSMUSP00000133433
Gene: ENSMUSG00000021519

DomainStartEndE-ValueType
low complexity region 97 117 N/A INTRINSIC
PDB:3OPG|A 121 204 2e-40 PDB
Blast:Mterf 161 196 1e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172807
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173062
Predicted Effect probably benign
Transcript: ENSMUST00000173158
SMART Domains Protein: ENSMUSP00000134032
Gene: ENSMUSG00000021519

DomainStartEndE-ValueType
low complexity region 97 108 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173407
SMART Domains Protein: ENSMUSP00000133594
Gene: ENSMUSG00000021519

DomainStartEndE-ValueType
low complexity region 97 108 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173773
Predicted Effect probably benign
Transcript: ENSMUST00000173910
SMART Domains Protein: ENSMUSP00000133456
Gene: ENSMUSG00000021519

DomainStartEndE-ValueType
low complexity region 23 41 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174011
Predicted Effect probably benign
Transcript: ENSMUST00000174339
SMART Domains Protein: ENSMUSP00000134286
Gene: ENSMUSG00000021519

DomainStartEndE-ValueType
low complexity region 97 117 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224085
Predicted Effect probably damaging
Transcript: ENSMUST00000224244
AA Change: T44A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect possibly damaging
Transcript: ENSMUST00000224290
AA Change: T44A

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of phosphatidylserine from either phosphatidylcholine or phosphatidylethanolamine. Phosphatidylserine localizes to the mitochondria-associated membrane of the endoplasmic reticulum, where it serves a structural role as well as a signaling role. Defects in this gene are a cause of Lenz-Majewski hyperostotic dwarfism. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased phosphatidylethanolamine and phosphatidylserine levels in the liver but normal axon growth and life span. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik G T 11: 58,880,993 A434S possibly damaging Het
Abhd8 T A 8: 71,461,873 D37V probably damaging Het
Acvr2a G A 2: 48,873,083 S97N probably benign Het
Ampd3 T A 7: 110,795,733 H296Q probably damaging Het
Arid4a G A 12: 71,075,338 S509N probably benign Het
Cap2 T G 13: 46,637,859 H167Q probably damaging Het
Car8 A G 4: 8,185,616 L180S probably damaging Het
Casp8 T A 1: 58,844,416 I314N probably damaging Het
Cavin2 T A 1: 51,301,171 S336T probably benign Het
Cdc14b A T 13: 64,225,602 I119N possibly damaging Het
Cemip T A 7: 83,964,038 I651F possibly damaging Het
Cfap57 T A 4: 118,595,940 D522V probably damaging Het
Clrn3 A T 7: 135,518,578 V93D probably damaging Het
Cyp4f39 A G 17: 32,482,202 D222G probably benign Het
D5Ertd579e A G 5: 36,616,109 V314A probably benign Het
Dchs1 C T 7: 105,754,921 V2805I probably benign Het
Dsp A T 13: 38,193,374 K1712* probably null Het
Emilin2 T C 17: 71,274,090 D547G probably benign Het
Erbb3 T C 10: 128,583,248 H248R probably benign Het
Erich3 A G 3: 154,762,623 probably benign Het
Fam213b C T 4: 154,897,063 V186I probably benign Het
Fbn1 T C 2: 125,309,781 T2518A probably damaging Het
Fzd2 G A 11: 102,605,881 V384M probably damaging Het
Gm14085 T C 2: 122,521,859 S366P probably damaging Het
Gpc5 T A 14: 115,370,098 S371T probably damaging Het
Hbb-bh2 T C 7: 103,839,155 K145R probably null Het
Hectd1 G T 12: 51,744,788 P2558Q probably damaging Het
Hgsnat C T 8: 25,954,605 probably null Het
Hirip3 T C 7: 126,863,475 probably null Het
Ispd T C 12: 36,476,721 C170R probably benign Het
Itpkc T C 7: 27,208,281 D666G probably damaging Het
Jmjd1c T A 10: 67,224,809 D693E probably benign Het
Katnbl1 T C 2: 112,406,109 L60P probably damaging Het
Kcna1 T A 6: 126,642,682 E225V probably damaging Het
Kcnj6 T A 16: 94,832,584 M223L probably damaging Het
Kcnk7 G T 19: 5,706,978 V332F probably benign Het
Kmt5a GAA GA 5: 124,459,885 probably null Het
Mdga2 C A 12: 66,568,772 G618V probably damaging Het
Mdga2 C A 12: 66,568,773 G618* probably null Het
Morc2b T C 17: 33,135,981 E939G possibly damaging Het
Mstn T A 1: 53,062,065 D100E probably benign Het
Mthfd1l G A 10: 4,083,877 probably null Het
Muc20 T A 16: 32,794,279 T243S probably damaging Het
Myo1d A T 11: 80,684,421 N156K probably damaging Het
Myo7a A G 7: 98,099,472 probably null Het
Naa35 A T 13: 59,612,676 Q274L probably damaging Het
Ncam1 G A 9: 49,557,172 T329I probably damaging Het
Nisch T C 14: 31,180,902 probably benign Het
Nlrp1b A T 11: 71,182,811 W69R probably benign Het
Nrap T A 19: 56,335,255 H1294L probably damaging Het
Nsun6 T A 2: 15,047,213 R56* probably null Het
Nudt1 A G 5: 140,334,623 probably null Het
Nxph4 T G 10: 127,526,208 K271N probably damaging Het
Olfr1196 T G 2: 88,701,317 H4P probably benign Het
Olfr243 T C 7: 103,717,112 W173R probably benign Het
Olfr366 A T 2: 37,219,641 R51* probably null Het
Olfr78 T A 7: 102,742,398 I202F probably damaging Het
Otud6b T A 4: 14,825,617 N71I probably damaging Het
Parp8 T A 13: 116,877,528 D623V probably damaging Het
Pcdhb5 T C 18: 37,320,752 S62P probably benign Het
Ppp1r12b A G 1: 134,777,452 S833P probably damaging Het
Ppp1r1a T G 15: 103,533,488 D51A probably damaging Het
Prag1 C A 8: 36,102,898 P212T probably damaging Het
Rab14 T C 2: 35,186,723 H83R possibly damaging Het
Rapgef3 C T 15: 97,761,182 G101E probably benign Het
Rimbp3 T A 16: 17,211,113 D800E probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Selenbp1 A G 3: 94,944,543 D465G probably damaging Het
Slc29a1 T C 17: 45,589,010 D251G probably damaging Het
Slc6a11 G T 6: 114,247,666 V604F probably benign Het
Sltm T A 9: 70,573,647 D260E probably damaging Het
Spta1 G A 1: 174,179,839 V212M probably damaging Het
St6gal2 T C 17: 55,496,395 probably null Het
Tc2n A G 12: 101,688,992 S235P probably damaging Het
Tenm3 T A 8: 48,417,119 N213I possibly damaging Het
Ticam2 T C 18: 46,560,610 T137A probably damaging Het
Ttn TCCC TCCCC 2: 76,742,907 probably null Het
Tyk2 G A 9: 21,115,249 Q684* probably null Het
Ubqln1 A G 13: 58,179,391 F478S possibly damaging Het
Uckl1 G A 2: 181,574,918 T78I probably damaging Het
Uhmk1 A G 1: 170,200,012 V372A probably damaging Het
Unc5c G A 3: 141,757,837 V240I possibly damaging Het
Ush2a T C 1: 188,728,585 L2681P probably damaging Het
Vmn2r1 C T 3: 64,090,182 Q420* probably null Het
Vmn2r101 A T 17: 19,611,922 T727S probably benign Het
Vmn2r79 A G 7: 87,002,631 T413A probably benign Het
Vps13c T C 9: 67,926,962 V1637A probably benign Het
Xpc A G 6: 91,492,947 V765A possibly damaging Het
Zbtb18 T G 1: 177,447,347 probably null Het
Zfp712 A T 13: 67,052,336 D28E probably benign Het
Zfp735 A G 11: 73,711,475 N415S possibly damaging Het
Other mutations in Ptdss1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01825:Ptdss1 APN 13 66987822 missense probably benign 0.02
IGL02798:Ptdss1 APN 13 66976760 missense probably damaging 1.00
IGL03114:Ptdss1 APN 13 66993994 nonsense probably null
R0344:Ptdss1 UTSW 13 66933572 missense probably damaging 1.00
R0591:Ptdss1 UTSW 13 66972650 splice site probably benign
R0749:Ptdss1 UTSW 13 66987850 nonsense probably null
R0759:Ptdss1 UTSW 13 66987804 missense probably damaging 1.00
R1140:Ptdss1 UTSW 13 66963356 missense probably benign 0.00
R1500:Ptdss1 UTSW 13 66995408 missense probably benign 0.04
R1761:Ptdss1 UTSW 13 66956412 missense possibly damaging 0.72
R2086:Ptdss1 UTSW 13 66953555 missense probably benign 0.00
R2087:Ptdss1 UTSW 13 66976817 splice site probably benign
R3962:Ptdss1 UTSW 13 66994011 missense probably benign 0.00
R4662:Ptdss1 UTSW 13 66933611 missense possibly damaging 0.95
R4707:Ptdss1 UTSW 13 66995418 critical splice donor site probably null
R4775:Ptdss1 UTSW 13 66987858 splice site probably null
R4993:Ptdss1 UTSW 13 66945288 missense probably benign 0.01
R5402:Ptdss1 UTSW 13 66933599 missense possibly damaging 0.88
R5463:Ptdss1 UTSW 13 66945301 missense probably damaging 1.00
R5643:Ptdss1 UTSW 13 66972540 missense probably damaging 1.00
R5644:Ptdss1 UTSW 13 66972540 missense probably damaging 1.00
R6043:Ptdss1 UTSW 13 66963369 missense probably damaging 1.00
R6145:Ptdss1 UTSW 13 66972637 critical splice donor site probably null
R6726:Ptdss1 UTSW 13 66953531 nonsense probably null
R7016:Ptdss1 UTSW 13 66972621 missense probably benign 0.00
R7116:Ptdss1 UTSW 13 66945327 missense probably benign 0.00
R7339:Ptdss1 UTSW 13 66963362 missense possibly damaging 0.78
R7836:Ptdss1 UTSW 13 66933655 missense probably benign
R7919:Ptdss1 UTSW 13 66933655 missense probably benign
R8015:Ptdss1 UTSW 13 66963343 missense possibly damaging 0.87
RF044:Ptdss1 UTSW 13 66945348 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- TACTAGGCTGCTTCTTCAGGCTGC -3'
(R):5'- AGCTAGGTGACCTGCATGAGTTCC -3'

Sequencing Primer
(F):5'- CTTCTCAGGGTGCCAGAC -3'
(R):5'- ACTGTAAGCCACGCGGTAG -3'
Posted On2014-05-09