Incidental Mutation 'R1676:Parp8'
ID188116
Institutional Source Beutler Lab
Gene Symbol Parp8
Ensembl Gene ENSMUSG00000021725
Gene Namepoly (ADP-ribose) polymerase family, member 8
SynonymsD13Ertd275e, 2810430O08Rik
MMRRC Submission 039712-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1676 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location116854820-117025537 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 116877528 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 623 (D623V)
Ref Sequence ENSEMBL: ENSMUSP00000022239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022239] [ENSMUST00000223949] [ENSMUST00000226107]
Predicted Effect probably damaging
Transcript: ENSMUST00000022239
AA Change: D623V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022239
Gene: ENSMUSG00000021725
AA Change: D623V

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
low complexity region 163 174 N/A INTRINSIC
low complexity region 217 228 N/A INTRINSIC
internal_repeat_1 332 410 4.61e-10 PROSPERO
internal_repeat_1 404 476 4.61e-10 PROSPERO
low complexity region 497 514 N/A INTRINSIC
Pfam:PARP 712 839 2e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000223949
AA Change: D584V

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000226107
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik G T 11: 58,880,993 A434S possibly damaging Het
Abhd8 T A 8: 71,461,873 D37V probably damaging Het
Acvr2a G A 2: 48,873,083 S97N probably benign Het
Ampd3 T A 7: 110,795,733 H296Q probably damaging Het
Arid4a G A 12: 71,075,338 S509N probably benign Het
Cap2 T G 13: 46,637,859 H167Q probably damaging Het
Car8 A G 4: 8,185,616 L180S probably damaging Het
Casp8 T A 1: 58,844,416 I314N probably damaging Het
Cavin2 T A 1: 51,301,171 S336T probably benign Het
Cdc14b A T 13: 64,225,602 I119N possibly damaging Het
Cemip T A 7: 83,964,038 I651F possibly damaging Het
Cfap57 T A 4: 118,595,940 D522V probably damaging Het
Clrn3 A T 7: 135,518,578 V93D probably damaging Het
Cyp4f39 A G 17: 32,482,202 D222G probably benign Het
D5Ertd579e A G 5: 36,616,109 V314A probably benign Het
Dchs1 C T 7: 105,754,921 V2805I probably benign Het
Dsp A T 13: 38,193,374 K1712* probably null Het
Emilin2 T C 17: 71,274,090 D547G probably benign Het
Erbb3 T C 10: 128,583,248 H248R probably benign Het
Erich3 A G 3: 154,762,623 probably benign Het
Fam213b C T 4: 154,897,063 V186I probably benign Het
Fbn1 T C 2: 125,309,781 T2518A probably damaging Het
Fzd2 G A 11: 102,605,881 V384M probably damaging Het
Gm14085 T C 2: 122,521,859 S366P probably damaging Het
Gpc5 T A 14: 115,370,098 S371T probably damaging Het
Hbb-bh2 T C 7: 103,839,155 K145R probably null Het
Hectd1 G T 12: 51,744,788 P2558Q probably damaging Het
Hgsnat C T 8: 25,954,605 probably null Het
Hirip3 T C 7: 126,863,475 probably null Het
Ispd T C 12: 36,476,721 C170R probably benign Het
Itpkc T C 7: 27,208,281 D666G probably damaging Het
Jmjd1c T A 10: 67,224,809 D693E probably benign Het
Katnbl1 T C 2: 112,406,109 L60P probably damaging Het
Kcna1 T A 6: 126,642,682 E225V probably damaging Het
Kcnj6 T A 16: 94,832,584 M223L probably damaging Het
Kcnk7 G T 19: 5,706,978 V332F probably benign Het
Kmt5a GAA GA 5: 124,459,885 probably null Het
Mdga2 C A 12: 66,568,772 G618V probably damaging Het
Mdga2 C A 12: 66,568,773 G618* probably null Het
Morc2b T C 17: 33,135,981 E939G possibly damaging Het
Mstn T A 1: 53,062,065 D100E probably benign Het
Mthfd1l G A 10: 4,083,877 probably null Het
Muc20 T A 16: 32,794,279 T243S probably damaging Het
Myo1d A T 11: 80,684,421 N156K probably damaging Het
Myo7a A G 7: 98,099,472 probably null Het
Naa35 A T 13: 59,612,676 Q274L probably damaging Het
Ncam1 G A 9: 49,557,172 T329I probably damaging Het
Nisch T C 14: 31,180,902 probably benign Het
Nlrp1b A T 11: 71,182,811 W69R probably benign Het
Nrap T A 19: 56,335,255 H1294L probably damaging Het
Nsun6 T A 2: 15,047,213 R56* probably null Het
Nudt1 A G 5: 140,334,623 probably null Het
Nxph4 T G 10: 127,526,208 K271N probably damaging Het
Olfr1196 T G 2: 88,701,317 H4P probably benign Het
Olfr243 T C 7: 103,717,112 W173R probably benign Het
Olfr366 A T 2: 37,219,641 R51* probably null Het
Olfr78 T A 7: 102,742,398 I202F probably damaging Het
Otud6b T A 4: 14,825,617 N71I probably damaging Het
Pcdhb5 T C 18: 37,320,752 S62P probably benign Het
Ppp1r12b A G 1: 134,777,452 S833P probably damaging Het
Ppp1r1a T G 15: 103,533,488 D51A probably damaging Het
Prag1 C A 8: 36,102,898 P212T probably damaging Het
Ptdss1 A G 13: 66,933,637 T44A probably damaging Het
Rab14 T C 2: 35,186,723 H83R possibly damaging Het
Rapgef3 C T 15: 97,761,182 G101E probably benign Het
Rimbp3 T A 16: 17,211,113 D800E probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Selenbp1 A G 3: 94,944,543 D465G probably damaging Het
Slc29a1 T C 17: 45,589,010 D251G probably damaging Het
Slc6a11 G T 6: 114,247,666 V604F probably benign Het
Sltm T A 9: 70,573,647 D260E probably damaging Het
Spta1 G A 1: 174,179,839 V212M probably damaging Het
St6gal2 T C 17: 55,496,395 probably null Het
Tc2n A G 12: 101,688,992 S235P probably damaging Het
Tenm3 T A 8: 48,417,119 N213I possibly damaging Het
Ticam2 T C 18: 46,560,610 T137A probably damaging Het
Ttn TCCC TCCCC 2: 76,742,907 probably null Het
Tyk2 G A 9: 21,115,249 Q684* probably null Het
Ubqln1 A G 13: 58,179,391 F478S possibly damaging Het
Uckl1 G A 2: 181,574,918 T78I probably damaging Het
Uhmk1 A G 1: 170,200,012 V372A probably damaging Het
Unc5c G A 3: 141,757,837 V240I possibly damaging Het
Ush2a T C 1: 188,728,585 L2681P probably damaging Het
Vmn2r1 C T 3: 64,090,182 Q420* probably null Het
Vmn2r101 A T 17: 19,611,922 T727S probably benign Het
Vmn2r79 A G 7: 87,002,631 T413A probably benign Het
Vps13c T C 9: 67,926,962 V1637A probably benign Het
Xpc A G 6: 91,492,947 V765A possibly damaging Het
Zbtb18 T G 1: 177,447,347 probably null Het
Zfp712 A T 13: 67,052,336 D28E probably benign Het
Zfp735 A G 11: 73,711,475 N415S possibly damaging Het
Other mutations in Parp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Parp8 APN 13 116927323 missense probably damaging 1.00
IGL01346:Parp8 APN 13 116895064 missense possibly damaging 0.72
IGL01793:Parp8 APN 13 116910879 missense probably damaging 1.00
IGL01926:Parp8 APN 13 116862302 splice site probably benign
IGL01958:Parp8 APN 13 116876572 missense probably benign 0.14
IGL02131:Parp8 APN 13 116910873 missense probably benign 0.08
IGL02398:Parp8 APN 13 116910863 critical splice donor site probably null
IGL02496:Parp8 APN 13 116862302 splice site probably benign
IGL03135:Parp8 APN 13 116910942 missense probably benign 0.41
IGL03143:Parp8 APN 13 116910961 splice site probably benign
IGL03201:Parp8 APN 13 116863069 splice site probably benign
blondi UTSW 13 116893041 missense possibly damaging 0.77
Heidi UTSW 13 116862204 splice site probably null
R0362:Parp8 UTSW 13 116924968 nonsense probably null
R0699:Parp8 UTSW 13 116922584 missense probably benign 0.01
R1445:Parp8 UTSW 13 117025350 utr 5 prime probably null
R1977:Parp8 UTSW 13 116910913 missense probably damaging 0.96
R2019:Parp8 UTSW 13 116868432 splice site probably benign
R2049:Parp8 UTSW 13 116894886 missense probably benign 0.20
R2142:Parp8 UTSW 13 116894886 missense probably benign 0.20
R2474:Parp8 UTSW 13 116893041 missense possibly damaging 0.77
R2566:Parp8 UTSW 13 116895687 missense possibly damaging 0.78
R3863:Parp8 UTSW 13 116894767 missense probably benign 0.01
R4126:Parp8 UTSW 13 116868469 missense possibly damaging 0.94
R4518:Parp8 UTSW 13 116895673 missense possibly damaging 0.62
R4519:Parp8 UTSW 13 116895673 missense possibly damaging 0.62
R4767:Parp8 UTSW 13 116868536 missense probably damaging 0.99
R5355:Parp8 UTSW 13 116862204 splice site probably null
R5633:Parp8 UTSW 13 116876580 missense probably damaging 1.00
R5942:Parp8 UTSW 13 116869433 missense probably benign 0.12
R5978:Parp8 UTSW 13 116895732 missense probably benign 0.01
R6039:Parp8 UTSW 13 116877598 missense probably damaging 1.00
R6039:Parp8 UTSW 13 116877598 missense probably damaging 1.00
R6753:Parp8 UTSW 13 116895115 missense possibly damaging 0.91
R7016:Parp8 UTSW 13 116895091 missense probably damaging 1.00
R7139:Parp8 UTSW 13 117025266 missense probably benign 0.21
R7305:Parp8 UTSW 13 116894925 missense possibly damaging 0.95
R7314:Parp8 UTSW 13 116868460 missense probably benign 0.01
R7360:Parp8 UTSW 13 116895771 missense probably benign 0.02
R7526:Parp8 UTSW 13 116894805 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTACGGAGATGGCGAGAAACAAC -3'
(R):5'- TACACTGAGCTGCCATGAACAGGAC -3'

Sequencing Primer
(F):5'- AAAGGGGGTTCTGTCCCTTG -3'
(R):5'- CTGCCATGAACAGGACAGATAG -3'
Posted On2014-05-09