Incidental Mutation 'R1677:Anapc1'
ID188154
Institutional Source Beutler Lab
Gene Symbol Anapc1
Ensembl Gene ENSMUSG00000014355
Gene Nameanaphase promoting complex subunit 1
Synonyms2610021O03Rik, tsg24, Apc1, Mcpr
MMRRC Submission 039713-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1677 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location128610104-128687391 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 128676208 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 242 (P242L)
Ref Sequence ENSEMBL: ENSMUSP00000105962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014499] [ENSMUST00000110333]
Predicted Effect probably benign
Transcript: ENSMUST00000014499
AA Change: P242L

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000014499
Gene: ENSMUSG00000014355
AA Change: P242L

DomainStartEndE-ValueType
Pfam:ANAPC1 150 214 1.7e-13 PFAM
low complexity region 323 345 N/A INTRINSIC
low complexity region 1404 1415 N/A INTRINSIC
Pfam:PC_rep 1467 1501 8.3e-8 PFAM
low complexity region 1516 1528 N/A INTRINSIC
low complexity region 1924 1936 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110333
AA Change: P242L

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000105962
Gene: ENSMUSG00000014355
AA Change: P242L

DomainStartEndE-ValueType
Pfam:Apc1 149 227 1.7e-22 PFAM
low complexity region 323 345 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134485
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 100% (95/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the anaphase-promoting complex. This complex is an E3 ubiquitin ligase that regulates progression through the metaphase to anaphase portion of the cell cycle by ubiquitinating proteins which targets them for degradation. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik A T 11: 23,517,357 M92K probably benign Het
4931406C07Rik T C 9: 15,301,364 probably null Het
A430005L14Rik G A 4: 153,960,900 V129M probably damaging Het
Actg2 T C 6: 83,522,819 T150A possibly damaging Het
Actn1 A T 12: 80,260,032 D20E probably benign Het
AI464131 C T 4: 41,497,947 R561H probably benign Het
Alcam C T 16: 52,270,773 E461K probably damaging Het
Ankrd49 A T 9: 14,781,378 D163E probably benign Het
Armc4 T C 18: 7,222,554 T572A probably benign Het
Atp8b5 G A 4: 43,372,903 R1149Q possibly damaging Het
Cacnb3 G T 15: 98,642,574 V328F probably damaging Het
Camk4 T C 18: 33,176,222 I226T probably damaging Het
Ccdc148 T C 2: 59,002,164 D172G probably damaging Het
Cdh12 A G 15: 21,520,405 I319V probably damaging Het
Cenpc1 T C 5: 86,061,998 probably benign Het
Cfap69 A C 5: 5,582,457 N15K probably damaging Het
Ckap2l A C 2: 129,285,167 S364A possibly damaging Het
Clic6 G A 16: 92,528,084 G36R probably damaging Het
Col6a3 T C 1: 90,821,861 Y417C probably benign Het
Cstf3 T A 2: 104,664,278 probably benign Het
Cyp4f39 G A 17: 32,492,330 A484T probably benign Het
Dnah3 T C 7: 119,928,740 N3829D probably damaging Het
Dntt C A 19: 41,029,484 P16T probably benign Het
Dym T A 18: 75,125,512 I447N probably damaging Het
Elmo1 T C 13: 20,589,671 V617A probably benign Het
Elovl7 G A 13: 108,282,626 G264D probably damaging Het
Epha7 T A 4: 28,947,571 Y610* probably null Het
Fn1 T C 1: 71,597,655 I178V probably benign Het
Fndc9 T C 11: 46,238,325 Y224H probably benign Het
Gad1 T C 2: 70,574,177 V137A probably damaging Het
Gapvd1 A G 2: 34,700,761 probably null Het
Gbp11 C T 5: 105,327,411 C357Y probably damaging Het
Gcc1 G A 6: 28,419,164 A390V probably benign Het
Gm6811 A G 17: 21,093,923 noncoding transcript Het
Gm884 A T 11: 103,614,942 S2067T probably benign Het
Gm9825 A T 6: 7,982,943 noncoding transcript Het
Htt A T 5: 34,828,574 D1063V probably damaging Het
Igfn1 C T 1: 135,971,101 A576T probably damaging Het
Il12rb2 T C 6: 67,303,501 Y240C probably damaging Het
Itga3 T C 11: 95,055,759 D747G probably damaging Het
Kcnip2 A C 19: 45,794,540 D134E probably damaging Het
Kif2b C A 11: 91,575,972 R495I probably damaging Het
Lef1 T C 3: 131,200,289 probably benign Het
Lias C T 5: 65,391,638 R4C probably damaging Het
Lpcat2 T C 8: 92,864,932 V68A probably benign Het
Lrrc8e A T 8: 4,234,190 K138N probably damaging Het
Map4k5 G A 12: 69,805,308 H767Y probably benign Het
Mga C A 2: 119,960,852 T2406K possibly damaging Het
Mtx1 A T 3: 89,209,341 S418T probably benign Het
Myh7 C T 14: 54,987,516 M531I probably benign Het
Ncaph2 T A 15: 89,371,224 M555K probably damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Ncoa6 T C 2: 155,402,664 probably benign Het
Nrp2 A G 1: 62,783,320 S691G probably benign Het
Odf2l A T 3: 145,139,782 probably null Het
Olfr1109 T A 2: 87,092,737 H220L probably benign Het
Pcdh20 A G 14: 88,467,974 V630A probably damaging Het
Pebp4 T C 14: 70,048,474 probably null Het
Ppfia3 T A 7: 45,356,666 M301L probably benign Het
Ppil2 A G 16: 17,103,610 L70P probably damaging Het
Ppp1r21 C A 17: 88,550,669 Q203K probably benign Het
Prr23a1 T C 9: 98,843,353 V256A probably benign Het
Rbfox1 A G 16: 7,292,227 R150G possibly damaging Het
Robo3 T C 9: 37,417,709 R1238G possibly damaging Het
Rp9 T G 9: 22,453,801 Q35P probably damaging Het
Rsrc1 C A 3: 67,355,475 A254E probably damaging Het
Shtn1 T A 19: 59,009,790 K390N probably damaging Het
Sidt2 C T 9: 45,953,219 V71I probably benign Het
Sirt7 A G 11: 120,624,539 V97A possibly damaging Het
Slc14a2 A G 18: 78,163,204 S466P probably benign Het
Slc2a10 T A 2: 165,515,441 D340E probably benign Het
Slc36a2 A C 11: 55,184,909 N17K probably benign Het
Slc4a10 A C 2: 62,324,727 N1086T probably benign Het
Sptb T C 12: 76,629,649 D177G probably damaging Het
Srpk2 A T 5: 23,525,750 probably null Het
Sucla2 T G 14: 73,592,681 V386G probably damaging Het
Susd1 G T 4: 59,424,089 N45K possibly damaging Het
Tbxas1 T C 6: 39,017,888 probably benign Het
Topors C T 4: 40,261,776 E503K probably damaging Het
Trpv5 T C 6: 41,657,797 R533G probably benign Het
Tshr A G 12: 91,537,341 H351R possibly damaging Het
Ube2f G A 1: 91,275,315 V94M probably damaging Het
Ugdh A G 5: 65,423,178 S216P probably damaging Het
Unc45b T A 11: 82,911,705 probably null Het
Vmn1r226 A G 17: 20,688,073 E189G probably damaging Het
Xrcc6 T G 15: 82,029,699 D75E probably benign Het
Zcwpw1 A T 5: 137,796,760 R73W probably damaging Het
Zfp219 T C 14: 52,009,055 E160G probably damaging Het
Zfp804b G T 5: 7,179,533 probably benign Het
Zscan22 C A 7: 12,906,803 P325T probably damaging Het
Other mutations in Anapc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Anapc1 APN 2 128645130 splice site probably benign
IGL00704:Anapc1 APN 2 128663984 missense possibly damaging 0.48
IGL01023:Anapc1 APN 2 128629729 missense probably damaging 1.00
IGL01432:Anapc1 APN 2 128633408 missense probably damaging 1.00
IGL01549:Anapc1 APN 2 128653170 missense probably benign
IGL02089:Anapc1 APN 2 128663933 missense probably damaging 1.00
IGL02275:Anapc1 APN 2 128659852 missense probably benign
IGL02570:Anapc1 APN 2 128645200 missense probably damaging 1.00
IGL02597:Anapc1 APN 2 128623931 missense probably benign 0.02
IGL02726:Anapc1 APN 2 128659785 missense probably benign 0.05
IGL03265:Anapc1 APN 2 128627197 missense probably damaging 1.00
IGL03304:Anapc1 APN 2 128627113 splice site probably benign
IGL03327:Anapc1 APN 2 128623934 missense probably benign 0.00
R0023:Anapc1 UTSW 2 128678218 missense probably damaging 0.99
R0027:Anapc1 UTSW 2 128641511 missense possibly damaging 0.96
R0027:Anapc1 UTSW 2 128641511 missense possibly damaging 0.96
R0084:Anapc1 UTSW 2 128623966 splice site probably benign
R0103:Anapc1 UTSW 2 128680452 splice site probably benign
R0103:Anapc1 UTSW 2 128680452 splice site probably benign
R0109:Anapc1 UTSW 2 128634693 missense probably damaging 1.00
R0109:Anapc1 UTSW 2 128634693 missense probably damaging 1.00
R0241:Anapc1 UTSW 2 128628629 missense possibly damaging 0.89
R0241:Anapc1 UTSW 2 128628629 missense possibly damaging 0.89
R0255:Anapc1 UTSW 2 128634711 missense probably damaging 0.99
R0377:Anapc1 UTSW 2 128641340 critical splice donor site probably null
R0467:Anapc1 UTSW 2 128669043 missense probably damaging 0.99
R0514:Anapc1 UTSW 2 128632655 missense probably damaging 0.99
R0591:Anapc1 UTSW 2 128619332 missense probably benign 0.17
R0919:Anapc1 UTSW 2 128617731 missense probably benign
R1175:Anapc1 UTSW 2 128680188 missense probably damaging 1.00
R1473:Anapc1 UTSW 2 128617697 missense possibly damaging 0.88
R1547:Anapc1 UTSW 2 128617556 missense probably benign 0.44
R1556:Anapc1 UTSW 2 128624899 missense probably benign 0.00
R1567:Anapc1 UTSW 2 128617716 missense probably damaging 1.00
R1635:Anapc1 UTSW 2 128628532 missense probably damaging 1.00
R1645:Anapc1 UTSW 2 128658246 critical splice donor site probably null
R1854:Anapc1 UTSW 2 128675890 missense probably damaging 1.00
R1856:Anapc1 UTSW 2 128659788 missense probably damaging 0.96
R1959:Anapc1 UTSW 2 128633415 missense probably benign 0.36
R1984:Anapc1 UTSW 2 128669688 missense possibly damaging 0.85
R2034:Anapc1 UTSW 2 128648458 missense possibly damaging 0.92
R2283:Anapc1 UTSW 2 128642548 missense probably benign 0.23
R2928:Anapc1 UTSW 2 128680137 missense probably damaging 1.00
R3547:Anapc1 UTSW 2 128642682 missense possibly damaging 0.58
R3904:Anapc1 UTSW 2 128642519 missense probably damaging 1.00
R4156:Anapc1 UTSW 2 128627229 intron probably benign
R4359:Anapc1 UTSW 2 128623556 missense possibly damaging 0.64
R4392:Anapc1 UTSW 2 128676249 critical splice acceptor site probably null
R4574:Anapc1 UTSW 2 128627195 missense probably damaging 1.00
R4682:Anapc1 UTSW 2 128664005 missense probably benign 0.05
R4770:Anapc1 UTSW 2 128686060 splice site probably benign
R4824:Anapc1 UTSW 2 128628690 missense possibly damaging 0.69
R4960:Anapc1 UTSW 2 128684594 missense probably benign 0.23
R5016:Anapc1 UTSW 2 128607175 unclassified probably benign
R5063:Anapc1 UTSW 2 128629549 missense possibly damaging 0.48
R5128:Anapc1 UTSW 2 128659917 missense probably benign
R5271:Anapc1 UTSW 2 128685985 nonsense probably null
R5363:Anapc1 UTSW 2 128650194 critical splice donor site probably null
R5469:Anapc1 UTSW 2 128675701 nonsense probably null
R5473:Anapc1 UTSW 2 128607195 unclassified probably benign
R5559:Anapc1 UTSW 2 128680434 nonsense probably null
R5631:Anapc1 UTSW 2 128657217 missense possibly damaging 0.85
R5747:Anapc1 UTSW 2 128624916 missense probably benign 0.19
R5840:Anapc1 UTSW 2 128607037 unclassified probably benign
R6226:Anapc1 UTSW 2 128650372 missense probably damaging 1.00
R6526:Anapc1 UTSW 2 128672135 nonsense probably null
R6561:Anapc1 UTSW 2 128663999 missense probably damaging 0.98
R6743:Anapc1 UTSW 2 128684534 nonsense probably null
R6799:Anapc1 UTSW 2 128659737 missense probably null 0.38
R6887:Anapc1 UTSW 2 128659768 missense possibly damaging 0.91
R6978:Anapc1 UTSW 2 128669900 missense probably benign 0.06
R7011:Anapc1 UTSW 2 128648681 splice site probably null
R7041:Anapc1 UTSW 2 128628656 missense possibly damaging 0.88
R7047:Anapc1 UTSW 2 128615430 missense probably damaging 0.96
R7074:Anapc1 UTSW 2 128678274 missense probably damaging 1.00
R7109:Anapc1 UTSW 2 128674602 missense probably benign 0.33
R7123:Anapc1 UTSW 2 128613010 missense probably damaging 1.00
R7309:Anapc1 UTSW 2 128674684 missense probably damaging 0.96
R7693:Anapc1 UTSW 2 128641537 missense possibly damaging 0.86
R7839:Anapc1 UTSW 2 128684608 missense probably damaging 0.99
R7847:Anapc1 UTSW 2 128669908 missense possibly damaging 0.93
R7960:Anapc1 UTSW 2 128674593 missense probably damaging 1.00
R8061:Anapc1 UTSW 2 128648488 missense probably damaging 0.98
R8127:Anapc1 UTSW 2 128632627 missense probably damaging 0.96
R8228:Anapc1 UTSW 2 128619917 nonsense probably null
R8402:Anapc1 UTSW 2 128630228 missense probably benign 0.02
R8422:Anapc1 UTSW 2 128675837 missense probably benign
R8425:Anapc1 UTSW 2 128669868 missense probably damaging 1.00
R8469:Anapc1 UTSW 2 128658344 splice site probably null
R8553:Anapc1 UTSW 2 128619913 missense possibly damaging 0.80
R8688:Anapc1 UTSW 2 128685828 missense not run
R8699:Anapc1 UTSW 2 128641453 missense not run
R8719:Anapc1 UTSW 2 128641449 missense not run
R8775:Anapc1 UTSW 2 128657173 missense possibly damaging 0.92
R8775-TAIL:Anapc1 UTSW 2 128657173 missense possibly damaging 0.92
R8806:Anapc1 UTSW 2 128622413 missense not run
X0066:Anapc1 UTSW 2 128674701 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TGCAAGTGTTCAGGGTTCGCTATC -3'
(R):5'- AACACCCTTTGCCTCTGGCTGATG -3'

Sequencing Primer
(F):5'- TATCTGTCATGGGACGCAGC -3'
(R):5'- GTCAGAGTGGAACAGTCATTATGTC -3'
Posted On2014-05-09