Incidental Mutation 'R1677:Zfp804b'
ID188169
Institutional Source Beutler Lab
Gene Symbol Zfp804b
Ensembl Gene ENSMUSG00000092094
Gene Namezinc finger protein 804B
SynonymsLOC207618
MMRRC Submission 039713-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R1677 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location6769010-7344756 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to T at 7179533 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000200317]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179460
SMART Domains Protein: ENSMUSP00000136922
Gene: ENSMUSG00000095159

DomainStartEndE-ValueType
Tubulin 47 243 6.6e-61 SMART
Tubulin_C 245 382 4.17e-49 SMART
low complexity region 427 444 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200317
SMART Domains Protein: ENSMUSP00000143568
Gene: ENSMUSG00000092094

DomainStartEndE-ValueType
ZnF_C2H2 56 80 2e-2 SMART
low complexity region 958 970 N/A INTRINSIC
low complexity region 1155 1179 N/A INTRINSIC
low complexity region 1196 1207 N/A INTRINSIC
low complexity region 1215 1234 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 100% (95/95)
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik A T 11: 23,517,357 M92K probably benign Het
4931406C07Rik T C 9: 15,301,364 probably null Het
A430005L14Rik G A 4: 153,960,900 V129M probably damaging Het
Actg2 T C 6: 83,522,819 T150A possibly damaging Het
Actn1 A T 12: 80,260,032 D20E probably benign Het
AI464131 C T 4: 41,497,947 R561H probably benign Het
Alcam C T 16: 52,270,773 E461K probably damaging Het
Anapc1 G A 2: 128,676,208 P242L probably benign Het
Ankrd49 A T 9: 14,781,378 D163E probably benign Het
Armc4 T C 18: 7,222,554 T572A probably benign Het
Atp8b5 G A 4: 43,372,903 R1149Q possibly damaging Het
Cacnb3 G T 15: 98,642,574 V328F probably damaging Het
Camk4 T C 18: 33,176,222 I226T probably damaging Het
Ccdc148 T C 2: 59,002,164 D172G probably damaging Het
Cdh12 A G 15: 21,520,405 I319V probably damaging Het
Cenpc1 T C 5: 86,061,998 probably benign Het
Cfap69 A C 5: 5,582,457 N15K probably damaging Het
Ckap2l A C 2: 129,285,167 S364A possibly damaging Het
Clic6 G A 16: 92,528,084 G36R probably damaging Het
Col6a3 T C 1: 90,821,861 Y417C probably benign Het
Cstf3 T A 2: 104,664,278 probably benign Het
Cyp4f39 G A 17: 32,492,330 A484T probably benign Het
Dnah3 T C 7: 119,928,740 N3829D probably damaging Het
Dntt C A 19: 41,029,484 P16T probably benign Het
Dym T A 18: 75,125,512 I447N probably damaging Het
Elmo1 T C 13: 20,589,671 V617A probably benign Het
Elovl7 G A 13: 108,282,626 G264D probably damaging Het
Epha7 T A 4: 28,947,571 Y610* probably null Het
Fn1 T C 1: 71,597,655 I178V probably benign Het
Fndc9 T C 11: 46,238,325 Y224H probably benign Het
Gad1 T C 2: 70,574,177 V137A probably damaging Het
Gapvd1 A G 2: 34,700,761 probably null Het
Gbp11 C T 5: 105,327,411 C357Y probably damaging Het
Gcc1 G A 6: 28,419,164 A390V probably benign Het
Gm6811 A G 17: 21,093,923 noncoding transcript Het
Gm884 A T 11: 103,614,942 S2067T probably benign Het
Gm9825 A T 6: 7,982,943 noncoding transcript Het
Htt A T 5: 34,828,574 D1063V probably damaging Het
Igfn1 C T 1: 135,971,101 A576T probably damaging Het
Il12rb2 T C 6: 67,303,501 Y240C probably damaging Het
Itga3 T C 11: 95,055,759 D747G probably damaging Het
Kcnip2 A C 19: 45,794,540 D134E probably damaging Het
Kif2b C A 11: 91,575,972 R495I probably damaging Het
Lef1 T C 3: 131,200,289 probably benign Het
Lias C T 5: 65,391,638 R4C probably damaging Het
Lpcat2 T C 8: 92,864,932 V68A probably benign Het
Lrrc8e A T 8: 4,234,190 K138N probably damaging Het
Map4k5 G A 12: 69,805,308 H767Y probably benign Het
Mga C A 2: 119,960,852 T2406K possibly damaging Het
Mtx1 A T 3: 89,209,341 S418T probably benign Het
Myh7 C T 14: 54,987,516 M531I probably benign Het
Ncaph2 T A 15: 89,371,224 M555K probably damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Ncoa6 T C 2: 155,402,664 probably benign Het
Nrp2 A G 1: 62,783,320 S691G probably benign Het
Odf2l A T 3: 145,139,782 probably null Het
Olfr1109 T A 2: 87,092,737 H220L probably benign Het
Pcdh20 A G 14: 88,467,974 V630A probably damaging Het
Pebp4 T C 14: 70,048,474 probably null Het
Ppfia3 T A 7: 45,356,666 M301L probably benign Het
Ppil2 A G 16: 17,103,610 L70P probably damaging Het
Ppp1r21 C A 17: 88,550,669 Q203K probably benign Het
Prr23a1 T C 9: 98,843,353 V256A probably benign Het
Rbfox1 A G 16: 7,292,227 R150G possibly damaging Het
Robo3 T C 9: 37,417,709 R1238G possibly damaging Het
Rp9 T G 9: 22,453,801 Q35P probably damaging Het
Rsrc1 C A 3: 67,355,475 A254E probably damaging Het
Shtn1 T A 19: 59,009,790 K390N probably damaging Het
Sidt2 C T 9: 45,953,219 V71I probably benign Het
Sirt7 A G 11: 120,624,539 V97A possibly damaging Het
Slc14a2 A G 18: 78,163,204 S466P probably benign Het
Slc2a10 T A 2: 165,515,441 D340E probably benign Het
Slc36a2 A C 11: 55,184,909 N17K probably benign Het
Slc4a10 A C 2: 62,324,727 N1086T probably benign Het
Sptb T C 12: 76,629,649 D177G probably damaging Het
Srpk2 A T 5: 23,525,750 probably null Het
Sucla2 T G 14: 73,592,681 V386G probably damaging Het
Susd1 G T 4: 59,424,089 N45K possibly damaging Het
Tbxas1 T C 6: 39,017,888 probably benign Het
Topors C T 4: 40,261,776 E503K probably damaging Het
Trpv5 T C 6: 41,657,797 R533G probably benign Het
Tshr A G 12: 91,537,341 H351R possibly damaging Het
Ube2f G A 1: 91,275,315 V94M probably damaging Het
Ugdh A G 5: 65,423,178 S216P probably damaging Het
Unc45b T A 11: 82,911,705 probably null Het
Vmn1r226 A G 17: 20,688,073 E189G probably damaging Het
Xrcc6 T G 15: 82,029,699 D75E probably benign Het
Zcwpw1 A T 5: 137,796,760 R73W probably damaging Het
Zfp219 T C 14: 52,009,055 E160G probably damaging Het
Zscan22 C A 7: 12,906,803 P325T probably damaging Het
Other mutations in Zfp804b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Zfp804b APN 5 6770931 missense probably damaging 1.00
IGL01726:Zfp804b APN 5 7180707 intron probably benign
IGL02020:Zfp804b APN 5 6769118 missense probably damaging 1.00
IGL02567:Zfp804b APN 5 6769989 missense probably benign 0.02
IGL02679:Zfp804b APN 5 6771392 missense possibly damaging 0.50
IGL03245:Zfp804b APN 5 6772253 missense possibly damaging 0.92
IGL03352:Zfp804b APN 5 6770039 missense probably benign 0.45
Flush UTSW 5 6770217 missense probably benign 0.27
gozinta UTSW 5 6770153 missense possibly damaging 0.90
healthy UTSW 5 6770013 missense probably benign 0.04
Paluka UTSW 5 6770534 missense probably benign
PIT4142001:Zfp804b UTSW 5 6769422 missense probably damaging 0.99
R0025:Zfp804b UTSW 5 6771665 missense probably damaging 1.00
R0044:Zfp804b UTSW 5 6769655 missense probably damaging 1.00
R0137:Zfp804b UTSW 5 6770534 missense probably benign
R0330:Zfp804b UTSW 5 6771029 missense possibly damaging 0.83
R0330:Zfp804b UTSW 5 6771994 missense possibly damaging 0.63
R0522:Zfp804b UTSW 5 6772014 missense probably benign 0.05
R1463:Zfp804b UTSW 5 7179372 intron probably benign
R1497:Zfp804b UTSW 5 6771105 missense probably damaging 0.97
R1511:Zfp804b UTSW 5 6769771 missense possibly damaging 0.87
R1633:Zfp804b UTSW 5 7179513 intron probably benign
R1666:Zfp804b UTSW 5 6771323 missense possibly damaging 0.93
R1668:Zfp804b UTSW 5 6771323 missense possibly damaging 0.93
R1698:Zfp804b UTSW 5 6769509 missense probably damaging 1.00
R1716:Zfp804b UTSW 5 6769673 missense probably benign 0.00
R1730:Zfp804b UTSW 5 6771938 missense probably damaging 0.99
R1747:Zfp804b UTSW 5 6770217 missense probably benign 0.27
R1776:Zfp804b UTSW 5 6769806 missense probably damaging 1.00
R1783:Zfp804b UTSW 5 6771938 missense probably damaging 0.99
R1804:Zfp804b UTSW 5 6771756 missense possibly damaging 0.78
R1885:Zfp804b UTSW 5 6770376 missense probably damaging 0.97
R1887:Zfp804b UTSW 5 6770376 missense probably damaging 0.97
R1900:Zfp804b UTSW 5 6769283 missense probably damaging 0.99
R1929:Zfp804b UTSW 5 6769748 missense probably benign 0.05
R2141:Zfp804b UTSW 5 6772583 missense probably benign 0.11
R2181:Zfp804b UTSW 5 6771674 missense probably damaging 1.00
R2401:Zfp804b UTSW 5 6769445 missense probably damaging 1.00
R2408:Zfp804b UTSW 5 7179410 intron probably benign
R3237:Zfp804b UTSW 5 6769239 missense probably benign
R3429:Zfp804b UTSW 5 7180625 intron probably benign
R3785:Zfp804b UTSW 5 6770153 missense possibly damaging 0.90
R4459:Zfp804b UTSW 5 6771481 missense probably damaging 0.99
R4460:Zfp804b UTSW 5 6771481 missense probably damaging 0.99
R4608:Zfp804b UTSW 5 6772584 missense probably benign 0.04
R4762:Zfp804b UTSW 5 6772250 missense probably benign 0.00
R4871:Zfp804b UTSW 5 6876479 missense probably damaging 1.00
R4910:Zfp804b UTSW 5 6770540 missense possibly damaging 0.69
R4973:Zfp804b UTSW 5 6771198 missense probably damaging 0.99
R5199:Zfp804b UTSW 5 6770013 missense probably benign 0.04
R5219:Zfp804b UTSW 5 6770703 missense probably benign 0.01
R5411:Zfp804b UTSW 5 6770071 missense probably benign 0.00
R6001:Zfp804b UTSW 5 6769043 missense probably benign 0.00
R6041:Zfp804b UTSW 5 6771231 missense probably benign 0.08
R6151:Zfp804b UTSW 5 6769910 missense probably benign
R6252:Zfp804b UTSW 5 6769478 missense probably damaging 0.99
R6283:Zfp804b UTSW 5 6769908 missense probably benign 0.01
R6346:Zfp804b UTSW 5 6770534 missense probably benign
R6520:Zfp804b UTSW 5 6769283 missense probably damaging 0.99
R6714:Zfp804b UTSW 5 6769239 missense probably benign 0.00
R6924:Zfp804b UTSW 5 6769902 missense probably benign 0.09
R6966:Zfp804b UTSW 5 6771615 missense probably damaging 1.00
R7027:Zfp804b UTSW 5 6770372 missense probably benign
R7042:Zfp804b UTSW 5 6770042 missense probably benign 0.00
R7076:Zfp804b UTSW 5 6769751 missense probably benign 0.02
R7099:Zfp804b UTSW 5 6772161 missense probably benign 0.37
R7574:Zfp804b UTSW 5 6772301 missense possibly damaging 0.74
R7609:Zfp804b UTSW 5 6770066 missense possibly damaging 0.90
R7654:Zfp804b UTSW 5 6769458 missense probably damaging 0.97
R7669:Zfp804b UTSW 5 6769362 missense probably damaging 1.00
R7717:Zfp804b UTSW 5 6771293 missense possibly damaging 0.50
R7721:Zfp804b UTSW 5 6771263 missense possibly damaging 0.55
R7830:Zfp804b UTSW 5 6771124 missense probably benign
X0027:Zfp804b UTSW 5 6771257 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTATCCTCAGAAAGTTCCTGTGTGGC -3'
(R):5'- AACCACTGTGTCCGACACCTTG -3'

Sequencing Primer
(F):5'- GATATAAGTACTACTCTGTGCGCC -3'
(R):5'- CCACACTGAAGGTGTTCATGATTC -3'
Posted On2014-05-09