Incidental Mutation 'R1677:Gm884'
ID188202
Institutional Source Beutler Lab
Gene Symbol Gm884
Ensembl Gene ENSMUSG00000034239
Gene Namepredicted gene 884
SynonymsLOC380730
MMRRC Submission 039713-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R1677 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location103534577-103621140 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103614942 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 2067 (S2067T)
Ref Sequence ENSEMBL: ENSMUSP00000058511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059279] [ENSMUST00000167262]
Predicted Effect probably benign
Transcript: ENSMUST00000059279
AA Change: S2067T

PolyPhen 2 Score 0.193 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000058511
Gene: ENSMUSG00000034239
AA Change: S2067T

DomainStartEndE-ValueType
Pfam:LRRC37 149 223 5.4e-10 PFAM
low complexity region 244 264 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
Pfam:LRRC37 335 403 1.9e-14 PFAM
Pfam:LRRC37 419 514 1.2e-8 PFAM
Pfam:LRRC37 565 620 2e-10 PFAM
Pfam:LRRC37 669 739 7.6e-18 PFAM
Pfam:LRRC37 741 792 1.6e-9 PFAM
Pfam:LRRC37 789 860 1.4e-23 PFAM
Pfam:LRRC37 861 914 2.8e-9 PFAM
Pfam:LRRC37 911 983 1.9e-23 PFAM
Pfam:LRRC37 979 1038 1e-8 PFAM
Pfam:LRRC37 1034 1105 2.7e-24 PFAM
Pfam:LRRC37 1105 1158 2.3e-9 PFAM
Pfam:LRRC37 1155 1219 2.4e-17 PFAM
Pfam:LRRC37 1222 1265 9.2e-7 PFAM
Pfam:LRRC37 1263 1330 4.9e-24 PFAM
Pfam:LRRC37 1331 1384 1.4e-10 PFAM
Pfam:LRRC37 1380 1451 4.3e-15 PFAM
Pfam:LRRC37 1487 1558 1.9e-15 PFAM
Pfam:LRRC37 1594 1665 2.9e-18 PFAM
Pfam:LRRC37 1701 1772 5.6e-23 PFAM
Pfam:LRRC37 1808 1910 2.8e-18 PFAM
Pfam:LRRC37 1915 1986 7.2e-17 PFAM
Pfam:LRRC37 2022 2093 4.9e-22 PFAM
Pfam:LRRC37 2129 2200 4.4e-22 PFAM
Pfam:LRRC37 2236 2307 2.1e-21 PFAM
Pfam:LRRC37 2343 2414 3.8e-17 PFAM
Pfam:LRRC37 2449 2519 1.6e-19 PFAM
LRR 2777 2796 3.09e1 SMART
LRR_TYP 2797 2820 2.09e-3 SMART
LRR 2821 2844 4.44e0 SMART
LRR 2848 2872 8.26e1 SMART
low complexity region 2991 3002 N/A INTRINSIC
low complexity region 3220 3230 N/A INTRINSIC
low complexity region 3382 3393 N/A INTRINSIC
Pfam:LRRC37AB_C 3424 3570 7.7e-76 PFAM
low complexity region 3571 3589 N/A INTRINSIC
low complexity region 3622 3640 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167262
SMART Domains Protein: ENSMUSP00000129662
Gene: ENSMUSG00000034239

DomainStartEndE-ValueType
internal_repeat_1 1 70 1.46e-11 PROSPERO
internal_repeat_1 108 290 1.46e-11 PROSPERO
LRR 601 620 3.09e1 SMART
LRR_TYP 621 644 2.09e-3 SMART
LRR 645 668 4.44e0 SMART
LRR 672 696 8.26e1 SMART
low complexity region 815 826 N/A INTRINSIC
low complexity region 1044 1054 N/A INTRINSIC
low complexity region 1206 1217 N/A INTRINSIC
Pfam:LRRC37AB_C 1243 1396 1.2e-92 PFAM
low complexity region 1446 1464 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 100% (95/95)
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik A T 11: 23,517,357 M92K probably benign Het
4931406C07Rik T C 9: 15,301,364 probably null Het
A430005L14Rik G A 4: 153,960,900 V129M probably damaging Het
Actg2 T C 6: 83,522,819 T150A possibly damaging Het
Actn1 A T 12: 80,260,032 D20E probably benign Het
AI464131 C T 4: 41,497,947 R561H probably benign Het
Alcam C T 16: 52,270,773 E461K probably damaging Het
Anapc1 G A 2: 128,676,208 P242L probably benign Het
Ankrd49 A T 9: 14,781,378 D163E probably benign Het
Armc4 T C 18: 7,222,554 T572A probably benign Het
Atp8b5 G A 4: 43,372,903 R1149Q possibly damaging Het
Cacnb3 G T 15: 98,642,574 V328F probably damaging Het
Camk4 T C 18: 33,176,222 I226T probably damaging Het
Ccdc148 T C 2: 59,002,164 D172G probably damaging Het
Cdh12 A G 15: 21,520,405 I319V probably damaging Het
Cenpc1 T C 5: 86,061,998 probably benign Het
Cfap69 A C 5: 5,582,457 N15K probably damaging Het
Ckap2l A C 2: 129,285,167 S364A possibly damaging Het
Clic6 G A 16: 92,528,084 G36R probably damaging Het
Col6a3 T C 1: 90,821,861 Y417C probably benign Het
Cstf3 T A 2: 104,664,278 probably benign Het
Cyp4f39 G A 17: 32,492,330 A484T probably benign Het
Dnah3 T C 7: 119,928,740 N3829D probably damaging Het
Dntt C A 19: 41,029,484 P16T probably benign Het
Dym T A 18: 75,125,512 I447N probably damaging Het
Elmo1 T C 13: 20,589,671 V617A probably benign Het
Elovl7 G A 13: 108,282,626 G264D probably damaging Het
Epha7 T A 4: 28,947,571 Y610* probably null Het
Fn1 T C 1: 71,597,655 I178V probably benign Het
Fndc9 T C 11: 46,238,325 Y224H probably benign Het
Gad1 T C 2: 70,574,177 V137A probably damaging Het
Gapvd1 A G 2: 34,700,761 probably null Het
Gbp11 C T 5: 105,327,411 C357Y probably damaging Het
Gcc1 G A 6: 28,419,164 A390V probably benign Het
Gm6811 A G 17: 21,093,923 noncoding transcript Het
Gm9825 A T 6: 7,982,943 noncoding transcript Het
Htt A T 5: 34,828,574 D1063V probably damaging Het
Igfn1 C T 1: 135,971,101 A576T probably damaging Het
Il12rb2 T C 6: 67,303,501 Y240C probably damaging Het
Itga3 T C 11: 95,055,759 D747G probably damaging Het
Kcnip2 A C 19: 45,794,540 D134E probably damaging Het
Kif2b C A 11: 91,575,972 R495I probably damaging Het
Lef1 T C 3: 131,200,289 probably benign Het
Lias C T 5: 65,391,638 R4C probably damaging Het
Lpcat2 T C 8: 92,864,932 V68A probably benign Het
Lrrc8e A T 8: 4,234,190 K138N probably damaging Het
Map4k5 G A 12: 69,805,308 H767Y probably benign Het
Mga C A 2: 119,960,852 T2406K possibly damaging Het
Mtx1 A T 3: 89,209,341 S418T probably benign Het
Myh7 C T 14: 54,987,516 M531I probably benign Het
Ncaph2 T A 15: 89,371,224 M555K probably damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Ncoa6 T C 2: 155,402,664 probably benign Het
Nrp2 A G 1: 62,783,320 S691G probably benign Het
Odf2l A T 3: 145,139,782 probably null Het
Olfr1109 T A 2: 87,092,737 H220L probably benign Het
Pcdh20 A G 14: 88,467,974 V630A probably damaging Het
Pebp4 T C 14: 70,048,474 probably null Het
Ppfia3 T A 7: 45,356,666 M301L probably benign Het
Ppil2 A G 16: 17,103,610 L70P probably damaging Het
Ppp1r21 C A 17: 88,550,669 Q203K probably benign Het
Prr23a1 T C 9: 98,843,353 V256A probably benign Het
Rbfox1 A G 16: 7,292,227 R150G possibly damaging Het
Robo3 T C 9: 37,417,709 R1238G possibly damaging Het
Rp9 T G 9: 22,453,801 Q35P probably damaging Het
Rsrc1 C A 3: 67,355,475 A254E probably damaging Het
Shtn1 T A 19: 59,009,790 K390N probably damaging Het
Sidt2 C T 9: 45,953,219 V71I probably benign Het
Sirt7 A G 11: 120,624,539 V97A possibly damaging Het
Slc14a2 A G 18: 78,163,204 S466P probably benign Het
Slc2a10 T A 2: 165,515,441 D340E probably benign Het
Slc36a2 A C 11: 55,184,909 N17K probably benign Het
Slc4a10 A C 2: 62,324,727 N1086T probably benign Het
Sptb T C 12: 76,629,649 D177G probably damaging Het
Srpk2 A T 5: 23,525,750 probably null Het
Sucla2 T G 14: 73,592,681 V386G probably damaging Het
Susd1 G T 4: 59,424,089 N45K possibly damaging Het
Tbxas1 T C 6: 39,017,888 probably benign Het
Topors C T 4: 40,261,776 E503K probably damaging Het
Trpv5 T C 6: 41,657,797 R533G probably benign Het
Tshr A G 12: 91,537,341 H351R possibly damaging Het
Ube2f G A 1: 91,275,315 V94M probably damaging Het
Ugdh A G 5: 65,423,178 S216P probably damaging Het
Unc45b T A 11: 82,911,705 probably null Het
Vmn1r226 A G 17: 20,688,073 E189G probably damaging Het
Xrcc6 T G 15: 82,029,699 D75E probably benign Het
Zcwpw1 A T 5: 137,796,760 R73W probably damaging Het
Zfp219 T C 14: 52,009,055 E160G probably damaging Het
Zfp804b G T 5: 7,179,533 probably benign Het
Zscan22 C A 7: 12,906,803 P325T probably damaging Het
Other mutations in Gm884
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Gm884 APN 11 103615410 missense probably benign 0.01
IGL00576:Gm884 APN 11 103617386 unclassified probably benign
IGL00813:Gm884 APN 11 103614498 missense probably benign 0.05
IGL01311:Gm884 APN 11 103534676 missense unknown
IGL01946:Gm884 APN 11 103612933 missense probably benign 0.28
IGL02217:Gm884 APN 11 103612871 splice site probably benign
IGL02556:Gm884 APN 11 103613283 missense probably benign 0.01
IGL02825:Gm884 APN 11 103617068 unclassified probably benign
IGL02868:Gm884 APN 11 103615139 missense probably benign 0.10
IGL02904:Gm884 APN 11 103616361 unclassified probably benign
IGL03008:Gm884 APN 11 103620467 missense unknown
IGL03120:Gm884 APN 11 103616975 unclassified probably benign
IGL03159:Gm884 APN 11 103604502 splice site probably benign
IGL03181:Gm884 APN 11 103616416 unclassified probably benign
IGL03202:Gm884 APN 11 103615373 missense probably benign 0.03
IGL03263:Gm884 APN 11 103613699 missense possibly damaging 0.86
PIT4486001:Gm884 UTSW 11 103618201 missense unknown
R0040:Gm884 UTSW 11 103542990 missense probably damaging 0.99
R0135:Gm884 UTSW 11 103618047 unclassified probably benign
R0141:Gm884 UTSW 11 103613686 missense probably damaging 1.00
R0226:Gm884 UTSW 11 103603241 missense probably benign 0.08
R0547:Gm884 UTSW 11 103620164 missense unknown
R0646:Gm884 UTSW 11 103613160 nonsense probably null
R0685:Gm884 UTSW 11 103616888 unclassified probably benign
R0732:Gm884 UTSW 11 103619838 missense unknown
R1015:Gm884 UTSW 11 103545796 missense probably benign 0.01
R1166:Gm884 UTSW 11 103615383 missense probably benign 0.21
R1168:Gm884 UTSW 11 103618950 unclassified probably benign
R1257:Gm884 UTSW 11 103534641 missense unknown
R1545:Gm884 UTSW 11 103608919 missense probably benign 0.16
R1570:Gm884 UTSW 11 103609938 missense possibly damaging 0.76
R1703:Gm884 UTSW 11 103540874 missense probably benign 0.39
R1719:Gm884 UTSW 11 103617071 unclassified probably benign
R1752:Gm884 UTSW 11 103614555 missense possibly damaging 0.67
R1870:Gm884 UTSW 11 103620605 missense unknown
R2155:Gm884 UTSW 11 103620459 missense unknown
R2191:Gm884 UTSW 11 103618967 unclassified probably benign
R2271:Gm884 UTSW 11 103614207 missense possibly damaging 0.53
R2378:Gm884 UTSW 11 103619711 unclassified probably benign
R2405:Gm884 UTSW 11 103620984 missense unknown
R2864:Gm884 UTSW 11 103540918 missense probably benign 0.34
R3011:Gm884 UTSW 11 103613103 missense possibly damaging 0.62
R3415:Gm884 UTSW 11 103614609 missense possibly damaging 0.82
R3417:Gm884 UTSW 11 103614609 missense possibly damaging 0.82
R3835:Gm884 UTSW 11 103620010 missense unknown
R3974:Gm884 UTSW 11 103619101 unclassified probably benign
R4019:Gm884 UTSW 11 103615293 missense probably benign 0.19
R4020:Gm884 UTSW 11 103615293 missense probably benign 0.19
R4176:Gm884 UTSW 11 103536600 missense unknown
R4361:Gm884 UTSW 11 103617501 frame shift probably null
R4418:Gm884 UTSW 11 103618314 unclassified probably benign
R4633:Gm884 UTSW 11 103619131 unclassified probably benign
R4693:Gm884 UTSW 11 103619860 missense unknown
R4758:Gm884 UTSW 11 103614464 missense possibly damaging 0.48
R4878:Gm884 UTSW 11 103617891 unclassified probably benign
R4887:Gm884 UTSW 11 103614872 missense probably benign 0.03
R4944:Gm884 UTSW 11 103613460 missense possibly damaging 0.68
R4952:Gm884 UTSW 11 103614207 missense possibly damaging 0.53
R5030:Gm884 UTSW 11 103534849 missense unknown
R5183:Gm884 UTSW 11 103543121 missense probably damaging 0.99
R5294:Gm884 UTSW 11 103616231 unclassified probably benign
R5317:Gm884 UTSW 11 103614145 missense possibly damaging 0.73
R5334:Gm884 UTSW 11 103613873 missense probably benign 0.18
R5426:Gm884 UTSW 11 103620760 missense unknown
R5467:Gm884 UTSW 11 103603265 nonsense probably null
R5518:Gm884 UTSW 11 103615253 missense probably benign 0.03
R5634:Gm884 UTSW 11 103542014 missense possibly damaging 0.95
R5647:Gm884 UTSW 11 103617474 unclassified probably benign
R5663:Gm884 UTSW 11 103613123 missense probably benign 0.01
R5668:Gm884 UTSW 11 103617054 unclassified probably benign
R5763:Gm884 UTSW 11 103613643 missense probably damaging 0.97
R5829:Gm884 UTSW 11 103541886 missense possibly damaging 0.95
R5871:Gm884 UTSW 11 103616454 unclassified probably benign
R5905:Gm884 UTSW 11 103614255 missense probably damaging 0.98
R5940:Gm884 UTSW 11 103613886 missense probably benign 0.18
R5964:Gm884 UTSW 11 103542120 missense possibly damaging 0.92
R5988:Gm884 UTSW 11 103615896 unclassified probably benign
R5992:Gm884 UTSW 11 103613792 missense possibly damaging 0.81
R6114:Gm884 UTSW 11 103617791 unclassified probably benign
R6154:Gm884 UTSW 11 103614143 missense probably benign 0.33
R6233:Gm884 UTSW 11 103613388 missense probably damaging 0.98
R6301:Gm884 UTSW 11 103618930 unclassified probably benign
R6362:Gm884 UTSW 11 103620652 missense unknown
R6471:Gm884 UTSW 11 103619622 unclassified probably benign
R6806:Gm884 UTSW 11 103621124 missense unknown
R6962:Gm884 UTSW 11 103614300 missense possibly damaging 0.67
R6996:Gm884 UTSW 11 103618757 nonsense probably null
R7028:Gm884 UTSW 11 103614537 missense probably benign 0.28
R7034:Gm884 UTSW 11 103615812 unclassified probably benign
R7036:Gm884 UTSW 11 103615812 unclassified probably benign
R7113:Gm884 UTSW 11 103618799 missense unknown
R7405:Gm884 UTSW 11 103615161 missense probably benign 0.02
R7420:Gm884 UTSW 11 103613625 missense probably benign 0.11
R7461:Gm884 UTSW 11 103616290 missense unknown
R7544:Gm884 UTSW 11 103615448 missense probably benign 0.01
R7613:Gm884 UTSW 11 103616290 missense unknown
R7711:Gm884 UTSW 11 103614912 missense probably benign 0.02
R7714:Gm884 UTSW 11 103616893 missense unknown
R7747:Gm884 UTSW 11 103614255 missense probably damaging 0.98
R7814:Gm884 UTSW 11 103614173 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- TCTGGAGGTTCAACTACCGTTCCC -3'
(R):5'- ATGCAGAGCCACCCATAAGAATGTC -3'

Sequencing Primer
(F):5'- CATGGGAGGTTCTGCATAATGAAG -3'
(R):5'- AGGTCAAGCTGAGTCTTCAC -3'
Posted On2014-05-09