Incidental Mutation 'R1677:Sptb'
ID188205
Institutional Source Beutler Lab
Gene Symbol Sptb
Ensembl Gene ENSMUSG00000021061
Gene Namespectrin beta, erythrocytic
SynonymsLOC383567, spectrin R, D330027P03Rik, brain erythroid spectrin (235E), Spnb-1, Spnb1
MMRRC Submission 039713-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.878) question?
Stock #R1677 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location76580488-76710547 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76629649 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 177 (D177G)
Ref Sequence ENSEMBL: ENSMUSP00000129782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021458] [ENSMUST00000166101]
Predicted Effect probably damaging
Transcript: ENSMUST00000021458
AA Change: D177G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021458
Gene: ENSMUSG00000021061
AA Change: D177G

DomainStartEndE-ValueType
CH 56 156 2.73e-26 SMART
CH 175 273 4.57e-28 SMART
SPEC 305 411 2.71e0 SMART
SPEC 425 525 4.65e-23 SMART
SPEC 531 634 4.51e-21 SMART
SPEC 640 740 3.02e-31 SMART
SPEC 746 845 1.47e-20 SMART
SPEC 851 951 1.04e-20 SMART
SPEC 957 1058 7.22e-20 SMART
SPEC 1064 1165 2.06e-24 SMART
SPEC 1171 1271 3.84e-15 SMART
SPEC 1277 1376 2.22e-20 SMART
SPEC 1382 1475 5.04e-10 SMART
SPEC 1481 1581 3.58e-24 SMART
SPEC 1587 1687 4.11e-24 SMART
SPEC 1693 1794 2.91e-24 SMART
SPEC 1800 1900 7.8e-16 SMART
SPEC 1906 2006 3.16e-25 SMART
SPEC 2012 2193 4.32e-9 SMART
PH 2180 2291 8.98e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166101
AA Change: D177G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129782
Gene: ENSMUSG00000021061
AA Change: D177G

DomainStartEndE-ValueType
CH 56 156 2.73e-26 SMART
CH 175 273 4.57e-28 SMART
SPEC 305 411 2.71e0 SMART
SPEC 425 525 4.65e-23 SMART
SPEC 531 634 4.51e-21 SMART
SPEC 640 740 3.02e-31 SMART
SPEC 746 845 1.47e-20 SMART
SPEC 851 951 1.04e-20 SMART
SPEC 957 1058 7.22e-20 SMART
SPEC 1064 1165 2.06e-24 SMART
SPEC 1171 1271 3.84e-15 SMART
SPEC 1277 1376 2.22e-20 SMART
SPEC 1382 1475 5.87e-11 SMART
SPEC 1481 1581 3.58e-24 SMART
SPEC 1587 1687 4.11e-24 SMART
SPEC 1693 1794 2.91e-24 SMART
SPEC 1800 1900 7.8e-16 SMART
SPEC 1906 2006 3.16e-25 SMART
SPEC 2012 2117 1.16e-9 SMART
Meta Mutation Damage Score 0.9100 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 100% (95/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the spectrin gene family. Spectrin proteins, along with ankyrin, play a role in cell membrane organization and stability. The protein encoded by this locus functions in stability of erythrocyte membranes, and mutations in this gene have been associated with spherocytosis type 2, hereditary elliptocytosis, and neonatal hemolytic anemia. Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit a severe microcytic anemia with erythrocyte fragility, hepatomegaly, and jaundice. Mutants die within a few days of birth. Heterozygotes are mildly anemic. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik A T 11: 23,517,357 M92K probably benign Het
4931406C07Rik T C 9: 15,301,364 probably null Het
A430005L14Rik G A 4: 153,960,900 V129M probably damaging Het
Actg2 T C 6: 83,522,819 T150A possibly damaging Het
Actn1 A T 12: 80,260,032 D20E probably benign Het
AI464131 C T 4: 41,497,947 R561H probably benign Het
Alcam C T 16: 52,270,773 E461K probably damaging Het
Anapc1 G A 2: 128,676,208 P242L probably benign Het
Ankrd49 A T 9: 14,781,378 D163E probably benign Het
Armc4 T C 18: 7,222,554 T572A probably benign Het
Atp8b5 G A 4: 43,372,903 R1149Q possibly damaging Het
Cacnb3 G T 15: 98,642,574 V328F probably damaging Het
Camk4 T C 18: 33,176,222 I226T probably damaging Het
Ccdc148 T C 2: 59,002,164 D172G probably damaging Het
Cdh12 A G 15: 21,520,405 I319V probably damaging Het
Cenpc1 T C 5: 86,061,998 probably benign Het
Cfap69 A C 5: 5,582,457 N15K probably damaging Het
Ckap2l A C 2: 129,285,167 S364A possibly damaging Het
Clic6 G A 16: 92,528,084 G36R probably damaging Het
Col6a3 T C 1: 90,821,861 Y417C probably benign Het
Cstf3 T A 2: 104,664,278 probably benign Het
Cyp4f39 G A 17: 32,492,330 A484T probably benign Het
Dnah3 T C 7: 119,928,740 N3829D probably damaging Het
Dntt C A 19: 41,029,484 P16T probably benign Het
Dym T A 18: 75,125,512 I447N probably damaging Het
Elmo1 T C 13: 20,589,671 V617A probably benign Het
Elovl7 G A 13: 108,282,626 G264D probably damaging Het
Epha7 T A 4: 28,947,571 Y610* probably null Het
Fn1 T C 1: 71,597,655 I178V probably benign Het
Fndc9 T C 11: 46,238,325 Y224H probably benign Het
Gad1 T C 2: 70,574,177 V137A probably damaging Het
Gapvd1 A G 2: 34,700,761 probably null Het
Gbp11 C T 5: 105,327,411 C357Y probably damaging Het
Gcc1 G A 6: 28,419,164 A390V probably benign Het
Gm6811 A G 17: 21,093,923 noncoding transcript Het
Gm884 A T 11: 103,614,942 S2067T probably benign Het
Gm9825 A T 6: 7,982,943 noncoding transcript Het
Htt A T 5: 34,828,574 D1063V probably damaging Het
Igfn1 C T 1: 135,971,101 A576T probably damaging Het
Il12rb2 T C 6: 67,303,501 Y240C probably damaging Het
Itga3 T C 11: 95,055,759 D747G probably damaging Het
Kcnip2 A C 19: 45,794,540 D134E probably damaging Het
Kif2b C A 11: 91,575,972 R495I probably damaging Het
Lef1 T C 3: 131,200,289 probably benign Het
Lias C T 5: 65,391,638 R4C probably damaging Het
Lpcat2 T C 8: 92,864,932 V68A probably benign Het
Lrrc8e A T 8: 4,234,190 K138N probably damaging Het
Map4k5 G A 12: 69,805,308 H767Y probably benign Het
Mga C A 2: 119,960,852 T2406K possibly damaging Het
Mtx1 A T 3: 89,209,341 S418T probably benign Het
Myh7 C T 14: 54,987,516 M531I probably benign Het
Ncaph2 T A 15: 89,371,224 M555K probably damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Ncoa6 T C 2: 155,402,664 probably benign Het
Nrp2 A G 1: 62,783,320 S691G probably benign Het
Odf2l A T 3: 145,139,782 probably null Het
Olfr1109 T A 2: 87,092,737 H220L probably benign Het
Pcdh20 A G 14: 88,467,974 V630A probably damaging Het
Pebp4 T C 14: 70,048,474 probably null Het
Ppfia3 T A 7: 45,356,666 M301L probably benign Het
Ppil2 A G 16: 17,103,610 L70P probably damaging Het
Ppp1r21 C A 17: 88,550,669 Q203K probably benign Het
Prr23a1 T C 9: 98,843,353 V256A probably benign Het
Rbfox1 A G 16: 7,292,227 R150G possibly damaging Het
Robo3 T C 9: 37,417,709 R1238G possibly damaging Het
Rp9 T G 9: 22,453,801 Q35P probably damaging Het
Rsrc1 C A 3: 67,355,475 A254E probably damaging Het
Shtn1 T A 19: 59,009,790 K390N probably damaging Het
Sidt2 C T 9: 45,953,219 V71I probably benign Het
Sirt7 A G 11: 120,624,539 V97A possibly damaging Het
Slc14a2 A G 18: 78,163,204 S466P probably benign Het
Slc2a10 T A 2: 165,515,441 D340E probably benign Het
Slc36a2 A C 11: 55,184,909 N17K probably benign Het
Slc4a10 A C 2: 62,324,727 N1086T probably benign Het
Srpk2 A T 5: 23,525,750 probably null Het
Sucla2 T G 14: 73,592,681 V386G probably damaging Het
Susd1 G T 4: 59,424,089 N45K possibly damaging Het
Tbxas1 T C 6: 39,017,888 probably benign Het
Topors C T 4: 40,261,776 E503K probably damaging Het
Trpv5 T C 6: 41,657,797 R533G probably benign Het
Tshr A G 12: 91,537,341 H351R possibly damaging Het
Ube2f G A 1: 91,275,315 V94M probably damaging Het
Ugdh A G 5: 65,423,178 S216P probably damaging Het
Unc45b T A 11: 82,911,705 probably null Het
Vmn1r226 A G 17: 20,688,073 E189G probably damaging Het
Xrcc6 T G 15: 82,029,699 D75E probably benign Het
Zcwpw1 A T 5: 137,796,760 R73W probably damaging Het
Zfp219 T C 14: 52,009,055 E160G probably damaging Het
Zfp804b G T 5: 7,179,533 probably benign Het
Zscan22 C A 7: 12,906,803 P325T probably damaging Het
Other mutations in Sptb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Sptb APN 12 76621331 missense probably benign 0.00
IGL00160:Sptb APN 12 76623169 missense probably damaging 1.00
IGL00229:Sptb APN 12 76620753 missense probably benign 0.20
IGL00820:Sptb APN 12 76632477 missense probably damaging 1.00
IGL01309:Sptb APN 12 76587463 missense probably benign 0.16
IGL01408:Sptb APN 12 76613147 missense possibly damaging 0.93
IGL01450:Sptb APN 12 76624240 missense possibly damaging 0.89
IGL01455:Sptb APN 12 76612912 missense probably damaging 1.00
IGL01457:Sptb APN 12 76612555 splice site probably benign
IGL01680:Sptb APN 12 76630682 missense probably damaging 1.00
IGL02070:Sptb APN 12 76605539 missense possibly damaging 0.82
IGL02346:Sptb APN 12 76621014 missense probably damaging 1.00
IGL02452:Sptb APN 12 76609036 critical splice donor site probably null
IGL02515:Sptb APN 12 76606487 missense possibly damaging 0.51
IGL02545:Sptb APN 12 76607980 critical splice donor site probably null
IGL02644:Sptb APN 12 76605617 missense probably damaging 1.00
IGL02878:Sptb APN 12 76620753 missense probably benign 0.20
IGL03007:Sptb APN 12 76621341 missense probably damaging 1.00
IGL03220:Sptb APN 12 76612910 missense probably benign 0.06
IGL03343:Sptb APN 12 76583556 unclassified probably benign
IGL03098:Sptb UTSW 12 76621499 missense probably damaging 1.00
PIT4472001:Sptb UTSW 12 76620686 missense probably damaging 1.00
R0047:Sptb UTSW 12 76622950 missense probably damaging 0.99
R0365:Sptb UTSW 12 76600383 missense probably benign 0.12
R0373:Sptb UTSW 12 76621371 missense probably benign 0.03
R0704:Sptb UTSW 12 76583594 missense probably damaging 0.99
R1005:Sptb UTSW 12 76601859 critical splice donor site probably null
R1109:Sptb UTSW 12 76603603 missense probably damaging 1.00
R1264:Sptb UTSW 12 76612607 missense probably damaging 1.00
R1358:Sptb UTSW 12 76621321 frame shift probably null
R1358:Sptb UTSW 12 76621326 missense probably damaging 1.00
R1459:Sptb UTSW 12 76611883 missense probably benign 0.01
R1518:Sptb UTSW 12 76604024 missense possibly damaging 0.95
R1628:Sptb UTSW 12 76583848 missense probably damaging 1.00
R1668:Sptb UTSW 12 76621169 missense probably benign
R1687:Sptb UTSW 12 76603699 missense possibly damaging 0.95
R1695:Sptb UTSW 12 76620867 missense probably benign 0.10
R1708:Sptb UTSW 12 76612574 missense probably damaging 1.00
R1761:Sptb UTSW 12 76612608 missense probably damaging 0.96
R1925:Sptb UTSW 12 76622253 missense probably damaging 1.00
R2011:Sptb UTSW 12 76632472 missense possibly damaging 0.95
R2373:Sptb UTSW 12 76621161 missense probably damaging 1.00
R2517:Sptb UTSW 12 76649869 missense possibly damaging 0.55
R2918:Sptb UTSW 12 76598758 missense probably damaging 0.97
R2961:Sptb UTSW 12 76603582 missense probably benign 0.19
R3409:Sptb UTSW 12 76610815 missense possibly damaging 0.78
R3410:Sptb UTSW 12 76610815 missense possibly damaging 0.78
R3411:Sptb UTSW 12 76610815 missense possibly damaging 0.78
R3744:Sptb UTSW 12 76600400 missense probably benign
R4112:Sptb UTSW 12 76597779 missense probably damaging 0.99
R4177:Sptb UTSW 12 76613179 missense probably benign 0.25
R4194:Sptb UTSW 12 76613010 missense probably benign 0.44
R4301:Sptb UTSW 12 76612697 missense probably damaging 1.00
R4555:Sptb UTSW 12 76612851 missense probably benign 0.03
R4619:Sptb UTSW 12 76583807 nonsense probably null
R4620:Sptb UTSW 12 76583807 nonsense probably null
R4625:Sptb UTSW 12 76587326 splice site probably null
R4728:Sptb UTSW 12 76583379 missense probably benign 0.00
R4751:Sptb UTSW 12 76627110 missense probably benign 0.07
R4810:Sptb UTSW 12 76623197 nonsense probably null
R4888:Sptb UTSW 12 76609037 missense probably benign 0.00
R4894:Sptb UTSW 12 76624994 critical splice donor site probably null
R5114:Sptb UTSW 12 76609278 missense probably damaging 1.00
R5191:Sptb UTSW 12 76612834 missense probably benign 0.12
R5479:Sptb UTSW 12 76599851 missense probably benign 0.04
R5646:Sptb UTSW 12 76587441 missense probably benign
R5725:Sptb UTSW 12 76623114 missense probably benign 0.25
R5727:Sptb UTSW 12 76623114 missense probably benign 0.25
R5797:Sptb UTSW 12 76603699 missense possibly damaging 0.95
R5874:Sptb UTSW 12 76598727 missense possibly damaging 0.91
R5952:Sptb UTSW 12 76632384 missense probably benign 0.02
R5956:Sptb UTSW 12 76604168 missense probably benign
R6298:Sptb UTSW 12 76620654 critical splice donor site probably null
R6470:Sptb UTSW 12 76612829 missense probably damaging 1.00
R6477:Sptb UTSW 12 76606392 missense probably damaging 1.00
R6736:Sptb UTSW 12 76613180 missense possibly damaging 0.49
R6854:Sptb UTSW 12 76603480 missense probably damaging 1.00
R6969:Sptb UTSW 12 76608007 missense probably damaging 1.00
R6987:Sptb UTSW 12 76613247 missense probably benign 0.00
R7023:Sptb UTSW 12 76625088 missense probably damaging 1.00
R7366:Sptb UTSW 12 76604194 missense probably damaging 1.00
R7379:Sptb UTSW 12 76610877 missense probably damaging 1.00
R7389:Sptb UTSW 12 76624229 missense probably damaging 0.98
R7392:Sptb UTSW 12 76624229 missense probably damaging 0.98
R7477:Sptb UTSW 12 76628565 missense probably damaging 1.00
R7653:Sptb UTSW 12 76628497 missense probably benign 0.06
R7684:Sptb UTSW 12 76612195 missense probably benign 0.06
R7846:Sptb UTSW 12 76608526 nonsense probably null
R7929:Sptb UTSW 12 76608526 nonsense probably null
X0057:Sptb UTSW 12 76630739 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGACTGGTGTCTAATGTCAAGGAGC -3'
(R):5'- GCATCTGATTACAGTCGTGCCCTC -3'

Sequencing Primer
(F):5'- aattcacaacagtagcaaaattacag -3'
(R):5'- GATACAGGGTGCTATCTCTGCC -3'
Posted On2014-05-09