Incidental Mutation 'R1677:Armc4'
ID188227
Institutional Source Beutler Lab
Gene Symbol Armc4
Ensembl Gene ENSMUSG00000061802
Gene Namearmadillo repeat containing 4
Synonymsb2b643Clo, 4930463I21Rik, b2b227.1Clo
MMRRC Submission 039713-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.260) question?
Stock #R1677 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location7088233-7297901 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 7222554 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 572 (T572A)
Ref Sequence ENSEMBL: ENSMUSP00000080028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081275]
Predicted Effect probably benign
Transcript: ENSMUST00000081275
AA Change: T572A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000080028
Gene: ENSMUSG00000061802
AA Change: T572A

DomainStartEndE-ValueType
low complexity region 172 186 N/A INTRINSIC
low complexity region 410 428 N/A INTRINSIC
ARM 475 516 1.38e1 SMART
ARM 517 557 2.38e-2 SMART
ARM 558 613 3.97e0 SMART
ARM 614 654 2.59e-3 SMART
ARM 655 695 3.48e1 SMART
ARM 696 737 1.6e1 SMART
ARM 738 778 4.09e0 SMART
ARM 779 819 9.68e0 SMART
ARM 861 903 3.52e0 SMART
ARM 904 944 1.26e1 SMART
ARM 945 985 1.03e1 SMART
ARM 986 1026 1.13e-3 SMART
Meta Mutation Damage Score 0.0630 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 100% (95/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains ten Armadillo repeat motifs (ARMs) and one HEAT repeat, and is thought to be involved in ciliary and flagellar movement. This protein has been shown to localize to the ciliary axonemes and at the ciliary base of respiratory cells. Studies indicate that mutations in this gene cause partial outer dynein arm (ODA) defects in respiratory cilia. The cilia of cells with mutations in this gene displayed either reduced ciliary beat frequency and amplitude, or, complete immotility. Some individuals with primary ciliary dyskensia (PCD) have been shown to have mutations in this gene. PCD is characterized by chronic airway disease and left/right body asymmetry defects. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for ENU-induced mutations exhibit situs inversus totalis or heterotaxia with congenital heart disease including double outlet right ventricle and ventricular septal defects. Dyskinetic, slow, or immotile airway cilia are also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik A T 11: 23,517,357 M92K probably benign Het
4931406C07Rik T C 9: 15,301,364 probably null Het
A430005L14Rik G A 4: 153,960,900 V129M probably damaging Het
Actg2 T C 6: 83,522,819 T150A possibly damaging Het
Actn1 A T 12: 80,260,032 D20E probably benign Het
AI464131 C T 4: 41,497,947 R561H probably benign Het
Alcam C T 16: 52,270,773 E461K probably damaging Het
Anapc1 G A 2: 128,676,208 P242L probably benign Het
Ankrd49 A T 9: 14,781,378 D163E probably benign Het
Atp8b5 G A 4: 43,372,903 R1149Q possibly damaging Het
Cacnb3 G T 15: 98,642,574 V328F probably damaging Het
Camk4 T C 18: 33,176,222 I226T probably damaging Het
Ccdc148 T C 2: 59,002,164 D172G probably damaging Het
Cdh12 A G 15: 21,520,405 I319V probably damaging Het
Cenpc1 T C 5: 86,061,998 probably benign Het
Cfap69 A C 5: 5,582,457 N15K probably damaging Het
Ckap2l A C 2: 129,285,167 S364A possibly damaging Het
Clic6 G A 16: 92,528,084 G36R probably damaging Het
Col6a3 T C 1: 90,821,861 Y417C probably benign Het
Cstf3 T A 2: 104,664,278 probably benign Het
Cyp4f39 G A 17: 32,492,330 A484T probably benign Het
Dnah3 T C 7: 119,928,740 N3829D probably damaging Het
Dntt C A 19: 41,029,484 P16T probably benign Het
Dym T A 18: 75,125,512 I447N probably damaging Het
Elmo1 T C 13: 20,589,671 V617A probably benign Het
Elovl7 G A 13: 108,282,626 G264D probably damaging Het
Epha7 T A 4: 28,947,571 Y610* probably null Het
Fn1 T C 1: 71,597,655 I178V probably benign Het
Fndc9 T C 11: 46,238,325 Y224H probably benign Het
Gad1 T C 2: 70,574,177 V137A probably damaging Het
Gapvd1 A G 2: 34,700,761 probably null Het
Gbp11 C T 5: 105,327,411 C357Y probably damaging Het
Gcc1 G A 6: 28,419,164 A390V probably benign Het
Gm6811 A G 17: 21,093,923 noncoding transcript Het
Gm884 A T 11: 103,614,942 S2067T probably benign Het
Gm9825 A T 6: 7,982,943 noncoding transcript Het
Htt A T 5: 34,828,574 D1063V probably damaging Het
Igfn1 C T 1: 135,971,101 A576T probably damaging Het
Il12rb2 T C 6: 67,303,501 Y240C probably damaging Het
Itga3 T C 11: 95,055,759 D747G probably damaging Het
Kcnip2 A C 19: 45,794,540 D134E probably damaging Het
Kif2b C A 11: 91,575,972 R495I probably damaging Het
Lef1 T C 3: 131,200,289 probably benign Het
Lias C T 5: 65,391,638 R4C probably damaging Het
Lpcat2 T C 8: 92,864,932 V68A probably benign Het
Lrrc8e A T 8: 4,234,190 K138N probably damaging Het
Map4k5 G A 12: 69,805,308 H767Y probably benign Het
Mga C A 2: 119,960,852 T2406K possibly damaging Het
Mtx1 A T 3: 89,209,341 S418T probably benign Het
Myh7 C T 14: 54,987,516 M531I probably benign Het
Ncaph2 T A 15: 89,371,224 M555K probably damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Ncoa6 T C 2: 155,402,664 probably benign Het
Nrp2 A G 1: 62,783,320 S691G probably benign Het
Odf2l A T 3: 145,139,782 probably null Het
Olfr1109 T A 2: 87,092,737 H220L probably benign Het
Pcdh20 A G 14: 88,467,974 V630A probably damaging Het
Pebp4 T C 14: 70,048,474 probably null Het
Ppfia3 T A 7: 45,356,666 M301L probably benign Het
Ppil2 A G 16: 17,103,610 L70P probably damaging Het
Ppp1r21 C A 17: 88,550,669 Q203K probably benign Het
Prr23a1 T C 9: 98,843,353 V256A probably benign Het
Rbfox1 A G 16: 7,292,227 R150G possibly damaging Het
Robo3 T C 9: 37,417,709 R1238G possibly damaging Het
Rp9 T G 9: 22,453,801 Q35P probably damaging Het
Rsrc1 C A 3: 67,355,475 A254E probably damaging Het
Shtn1 T A 19: 59,009,790 K390N probably damaging Het
Sidt2 C T 9: 45,953,219 V71I probably benign Het
Sirt7 A G 11: 120,624,539 V97A possibly damaging Het
Slc14a2 A G 18: 78,163,204 S466P probably benign Het
Slc2a10 T A 2: 165,515,441 D340E probably benign Het
Slc36a2 A C 11: 55,184,909 N17K probably benign Het
Slc4a10 A C 2: 62,324,727 N1086T probably benign Het
Sptb T C 12: 76,629,649 D177G probably damaging Het
Srpk2 A T 5: 23,525,750 probably null Het
Sucla2 T G 14: 73,592,681 V386G probably damaging Het
Susd1 G T 4: 59,424,089 N45K possibly damaging Het
Tbxas1 T C 6: 39,017,888 probably benign Het
Topors C T 4: 40,261,776 E503K probably damaging Het
Trpv5 T C 6: 41,657,797 R533G probably benign Het
Tshr A G 12: 91,537,341 H351R possibly damaging Het
Ube2f G A 1: 91,275,315 V94M probably damaging Het
Ugdh A G 5: 65,423,178 S216P probably damaging Het
Unc45b T A 11: 82,911,705 probably null Het
Vmn1r226 A G 17: 20,688,073 E189G probably damaging Het
Xrcc6 T G 15: 82,029,699 D75E probably benign Het
Zcwpw1 A T 5: 137,796,760 R73W probably damaging Het
Zfp219 T C 14: 52,009,055 E160G probably damaging Het
Zfp804b G T 5: 7,179,533 probably benign Het
Zscan22 C A 7: 12,906,803 P325T probably damaging Het
Other mutations in Armc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Armc4 APN 18 7211504 missense probably damaging 0.96
IGL00822:Armc4 APN 18 7181817 missense probably damaging 1.00
IGL01345:Armc4 APN 18 7266947 missense probably benign 0.00
IGL01593:Armc4 APN 18 7127345 missense probably benign 0.00
IGL01645:Armc4 APN 18 7268491 missense probably benign 0.00
IGL01863:Armc4 APN 18 7222617 missense probably damaging 1.00
IGL01955:Armc4 APN 18 7127291 missense possibly damaging 0.89
IGL02013:Armc4 APN 18 7265157 splice site probably benign
IGL02142:Armc4 APN 18 7214601 missense probably damaging 1.00
IGL02399:Armc4 APN 18 7285719 missense probably benign
IGL02439:Armc4 APN 18 7268444 missense probably benign 0.04
IGL02452:Armc4 APN 18 7129461 missense probably damaging 1.00
IGL02632:Armc4 APN 18 7214727 splice site probably benign
IGL03344:Armc4 APN 18 7129434 nonsense probably null
R0062:Armc4 UTSW 18 7129593 splice site probably benign
R0062:Armc4 UTSW 18 7129593 splice site probably benign
R0242:Armc4 UTSW 18 7211516 missense probably damaging 0.96
R0242:Armc4 UTSW 18 7211516 missense probably damaging 0.96
R0365:Armc4 UTSW 18 7217800 missense probably benign 0.01
R0377:Armc4 UTSW 18 7127415 missense probably benign 0.04
R0466:Armc4 UTSW 18 7286758 missense probably benign 0.10
R0517:Armc4 UTSW 18 7223621 missense probably damaging 1.00
R0521:Armc4 UTSW 18 7222676 missense possibly damaging 0.64
R0841:Armc4 UTSW 18 7268436 missense probably damaging 0.99
R1145:Armc4 UTSW 18 7268436 missense probably damaging 0.99
R1145:Armc4 UTSW 18 7268436 missense probably damaging 0.99
R1435:Armc4 UTSW 18 7222646 missense probably benign 0.01
R1487:Armc4 UTSW 18 7273245 missense probably damaging 0.98
R1634:Armc4 UTSW 18 7286688 missense probably damaging 0.99
R1778:Armc4 UTSW 18 7127388 missense probably damaging 1.00
R1792:Armc4 UTSW 18 7286743 missense probably benign 0.00
R1809:Armc4 UTSW 18 7211630 missense probably benign 0.08
R1842:Armc4 UTSW 18 7223551 missense probably benign 0.04
R2144:Armc4 UTSW 18 7127229 missense probably damaging 0.96
R2206:Armc4 UTSW 18 7223676 missense probably benign 0.25
R2273:Armc4 UTSW 18 7223676 missense probably benign 0.25
R2275:Armc4 UTSW 18 7223676 missense probably benign 0.25
R2918:Armc4 UTSW 18 7222625 missense probably benign 0.04
R3421:Armc4 UTSW 18 7223523 splice site probably benign
R3422:Armc4 UTSW 18 7223523 splice site probably benign
R4165:Armc4 UTSW 18 7217008 missense probably damaging 1.00
R4225:Armc4 UTSW 18 7181732 critical splice donor site probably null
R4660:Armc4 UTSW 18 7211609 missense possibly damaging 0.88
R4745:Armc4 UTSW 18 7286763 missense probably benign 0.28
R4812:Armc4 UTSW 18 7288634 missense possibly damaging 0.79
R4831:Armc4 UTSW 18 7222564 missense possibly damaging 0.79
R4923:Armc4 UTSW 18 7181787 missense probably damaging 0.97
R4995:Armc4 UTSW 18 7223663 missense probably damaging 1.00
R5024:Armc4 UTSW 18 7088555 missense probably benign 0.02
R5335:Armc4 UTSW 18 7294566 missense probably benign 0.06
R5434:Armc4 UTSW 18 7222550 missense probably benign 0.03
R5552:Armc4 UTSW 18 7285360 missense possibly damaging 0.51
R5719:Armc4 UTSW 18 7211496 missense probably benign 0.00
R5736:Armc4 UTSW 18 7268416 missense probably benign 0.01
R5792:Armc4 UTSW 18 7217965 missense probably benign 0.00
R5848:Armc4 UTSW 18 7268507 synonymous probably null
R5957:Armc4 UTSW 18 7285706 missense probably benign 0.01
R6001:Armc4 UTSW 18 7286838 missense probably benign 0.03
R6309:Armc4 UTSW 18 7214617 missense probably benign 0.04
R6559:Armc4 UTSW 18 7223664 missense probably damaging 0.99
R6574:Armc4 UTSW 18 7129394 splice site probably null
R6581:Armc4 UTSW 18 7129560 missense possibly damaging 0.77
R6736:Armc4 UTSW 18 7223586 missense probably damaging 0.98
R6842:Armc4 UTSW 18 7268401 missense probably benign 0.00
R6968:Armc4 UTSW 18 7273155 splice site probably null
R6974:Armc4 UTSW 18 7294479 missense probably benign 0.37
R7024:Armc4 UTSW 18 7211593 missense probably benign 0.43
R7299:Armc4 UTSW 18 7222635 missense probably damaging 1.00
R7578:Armc4 UTSW 18 7211593 missense probably benign 0.43
R7737:Armc4 UTSW 18 7217890 missense probably damaging 1.00
R7878:Armc4 UTSW 18 7217801 missense probably benign 0.01
R7961:Armc4 UTSW 18 7217801 missense probably benign 0.01
R8025:Armc4 UTSW 18 7127224 missense not run
Z1088:Armc4 UTSW 18 7266919 missense probably benign
Z1176:Armc4 UTSW 18 7129487 missense not run
Z1176:Armc4 UTSW 18 7216973 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCCATGTTACAaaacaaaacaaacaaacaaa -3'
(R):5'- TGCCTCATTGTCGTTCACTGTCATT -3'

Sequencing Primer
(F):5'- caaaacaaacaaacaaacaaacaaac -3'
(R):5'- ggagtgggtaggtagggg -3'
Posted On2014-05-09