Incidental Mutation 'R1678:Cnga3'
ID 188235
Institutional Source Beutler Lab
Gene Symbol Cnga3
Ensembl Gene ENSMUSG00000026114
Gene Name cyclic nucleotide gated channel alpha 3
Synonyms CNG3
MMRRC Submission 039714-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1678 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 37257317-37302465 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 37300579 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 471 (V471A)
Ref Sequence ENSEMBL: ENSMUSP00000142175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027288] [ENSMUST00000194195] [ENSMUST00000195272]
AlphaFold Q9JJZ8
Predicted Effect possibly damaging
Transcript: ENSMUST00000027288
AA Change: V433A

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000027288
Gene: ENSMUSG00000026114
AA Change: V433A

DomainStartEndE-ValueType
Pfam:Ion_trans 109 351 1.3e-30 PFAM
cNMP 423 547 2.5e-28 SMART
PDB:3SWY|C 567 610 2e-14 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000194195
AA Change: V433A

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142075
Gene: ENSMUSG00000026114
AA Change: V433A

DomainStartEndE-ValueType
Pfam:Ion_trans 146 340 1.3e-15 PFAM
cNMP 423 547 2.4e-28 SMART
PDB:3SWY|C 567 610 2e-14 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000195272
AA Change: V471A

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142175
Gene: ENSMUSG00000026114
AA Change: V471A

DomainStartEndE-ValueType
Pfam:Ion_trans 184 378 1.5e-15 PFAM
cNMP 461 585 2.4e-28 SMART
PDB:3SWY|C 605 648 3e-14 PDB
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cyclic nucleotide-gated cation channel protein family which is required for normal vision and olfactory signal transduction. Mutations in this gene are associated with achromatopsia (rod monochromacy) and color blindness. Two alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant animals experience progressive loss of cone photoreceptor cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A C 17: 24,554,594 (GRCm39) I120S probably benign Het
Abcb5 A C 12: 118,929,064 (GRCm39) probably benign Het
Abcc4 T A 14: 118,832,306 (GRCm39) T775S probably benign Het
Acnat2 T A 4: 49,380,568 (GRCm39) Y270F probably damaging Het
Aif1 G A 17: 35,391,127 (GRCm39) P44L probably benign Het
Ankib1 A G 5: 3,756,301 (GRCm39) I548T probably damaging Het
Apbb1ip A T 2: 22,764,892 (GRCm39) probably null Het
Asb17 C T 3: 153,550,004 (GRCm39) S12F probably damaging Het
Atad2b G A 12: 5,015,899 (GRCm39) V542I possibly damaging Het
Atxn7 T C 14: 14,096,239 (GRCm38) F515L probably damaging Het
Bicc1 A G 10: 70,779,348 (GRCm39) L680P probably damaging Het
Bpifb6 G A 2: 153,750,562 (GRCm39) R351H probably damaging Het
C4b A G 17: 34,962,624 (GRCm39) F26S probably benign Het
Cadps A G 14: 12,517,802 (GRCm38) probably null Het
Capza1 G T 3: 104,771,669 (GRCm39) S9* probably null Het
Ccl11 C T 11: 81,948,866 (GRCm39) P25L probably damaging Het
Cdyl A T 13: 36,040,872 (GRCm39) K306N probably damaging Het
Col4a4 T C 1: 82,464,380 (GRCm39) K983E unknown Het
Cp A C 3: 20,026,881 (GRCm39) K436N probably damaging Het
Csmd1 T A 8: 15,968,252 (GRCm39) D3125V possibly damaging Het
Daw1 A T 1: 83,161,087 (GRCm39) N143I probably damaging Het
Dmd T A X: 84,018,368 (GRCm39) I3067N probably benign Het
Dnaaf9 A G 2: 130,656,193 (GRCm39) V105A probably damaging Het
Dnah11 T G 12: 117,897,580 (GRCm39) N3550T possibly damaging Het
Dnm2 T C 9: 21,378,828 (GRCm39) V129A possibly damaging Het
Dync1h1 A T 12: 110,632,096 (GRCm39) probably null Het
Dync2i1 A G 12: 116,189,590 (GRCm39) S640P probably damaging Het
Efemp1 G A 11: 28,866,942 (GRCm39) E325K probably benign Het
Enox1 A G 14: 77,815,096 (GRCm39) T85A probably benign Het
Faim2 C A 15: 99,418,217 (GRCm39) V123F possibly damaging Het
Fgfr2 T C 7: 129,830,350 (GRCm39) probably null Het
Fign T C 2: 63,810,718 (GRCm39) E184G probably damaging Het
Fnd3c2 T C X: 105,281,305 (GRCm39) T799A probably benign Het
Frem2 T C 3: 53,427,359 (GRCm39) D2931G probably damaging Het
Fsip2 A G 2: 82,816,689 (GRCm39) T4141A probably benign Het
Gigyf2 T A 1: 87,344,705 (GRCm39) M546K probably benign Het
Gm21775 G A Y: 10,553,867 (GRCm39) V139M probably damaging Het
Gpr83 G T 9: 14,778,145 (GRCm39) V172F probably damaging Het
Itprid1 G T 6: 55,945,499 (GRCm39) C740F probably benign Het
Jmjd4 A G 11: 59,344,438 (GRCm39) Y179C probably damaging Het
Kcnq3 A G 15: 65,903,281 (GRCm39) L143P probably damaging Het
Klhl41 T C 2: 69,501,283 (GRCm39) V248A probably benign Het
Lama1 T C 17: 68,117,150 (GRCm39) Y2482H possibly damaging Het
Lamb2 A T 9: 108,360,885 (GRCm39) probably null Het
Lclat1 G A 17: 73,503,715 (GRCm39) G162R probably damaging Het
Map6 T C 7: 98,917,305 (GRCm39) V26A probably damaging Het
Mdn1 A T 4: 32,663,050 (GRCm39) D107V probably damaging Het
Metap1d T A 2: 71,355,121 (GRCm39) V304D possibly damaging Het
Naca A G 10: 127,879,395 (GRCm39) probably benign Het
Napg T C 18: 63,117,143 (GRCm39) probably null Het
Nbeal1 T A 1: 60,299,493 (GRCm39) F7L probably benign Het
Ndst2 T C 14: 20,774,582 (GRCm39) T825A probably benign Het
Nsun2 T C 13: 69,775,222 (GRCm39) I353T probably damaging Het
Nt5c3b T A 11: 100,327,036 (GRCm39) I87F probably damaging Het
Nxf3 T C X: 134,976,270 (GRCm39) D407G probably damaging Het
Or51f2 T A 7: 102,526,870 (GRCm39) V181E probably damaging Het
Or8c13 A T 9: 38,091,933 (GRCm39) F62Y possibly damaging Het
Osbpl3 A C 6: 50,313,193 (GRCm39) probably null Het
P2rx3 T C 2: 84,852,811 (GRCm39) T172A possibly damaging Het
Pcdh10 G T 3: 45,336,316 (GRCm39) E877* probably null Het
Pcdhb9 A T 18: 37,534,682 (GRCm39) K225N probably damaging Het
Plch1 A G 3: 63,648,115 (GRCm39) S419P probably damaging Het
Prex2 T G 1: 11,355,313 (GRCm39) I1538S possibly damaging Het
Prss59 C A 6: 40,906,453 (GRCm39) probably benign Het
Rasl10a A G 11: 5,009,815 (GRCm39) E121G possibly damaging Het
Rbbp8 A G 18: 11,865,372 (GRCm39) T754A probably benign Het
Rictor T C 15: 6,785,952 (GRCm39) V156A probably benign Het
Ryr1 A T 7: 28,815,579 (GRCm39) Y104N probably damaging Het
Sctr G T 1: 119,964,169 (GRCm39) probably null Het
Sptbn2 T C 19: 4,800,525 (GRCm39) Y2247H probably damaging Het
Sqle C T 15: 59,196,358 (GRCm39) R384W probably damaging Het
Srcin1 C A 11: 97,409,470 (GRCm39) R1163L probably damaging Het
Srp72 A G 5: 77,128,154 (GRCm39) Y125C probably damaging Het
Srrm2 T C 17: 24,037,960 (GRCm39) S1535P probably benign Het
Sumf2 A G 5: 129,883,557 (GRCm39) E125G possibly damaging Het
Tas2r144 A T 6: 42,192,490 (GRCm39) I77F probably benign Het
Tcerg1 T C 18: 42,657,414 (GRCm39) S299P unknown Het
Tcp1 T A 17: 13,139,310 (GRCm39) N212K probably benign Het
Ttc7 G T 17: 87,669,329 (GRCm39) G659C probably damaging Het
Ttn A T 2: 76,691,903 (GRCm39) probably null Het
Ubtf A T 11: 102,199,804 (GRCm39) D440E probably benign Het
Usp30 A G 5: 114,259,207 (GRCm39) D428G probably damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,578,962 (GRCm39) probably benign Het
Vmn2r58 G A 7: 41,513,480 (GRCm39) H388Y probably benign Het
Zbtb49 T C 5: 38,371,038 (GRCm39) D281G probably damaging Het
Zfp248 A G 6: 118,406,765 (GRCm39) S174P probably benign Het
Zswim9 T C 7: 13,011,337 (GRCm39) T4A probably benign Het
Other mutations in Cnga3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01636:Cnga3 APN 1 37,299,874 (GRCm39) missense possibly damaging 0.89
IGL01677:Cnga3 APN 1 37,283,999 (GRCm39) nonsense probably null
IGL02475:Cnga3 APN 1 37,297,072 (GRCm39) critical splice acceptor site probably null
IGL03145:Cnga3 APN 1 37,300,755 (GRCm39) missense probably damaging 1.00
R1557:Cnga3 UTSW 1 37,300,066 (GRCm39) missense probably damaging 1.00
R1622:Cnga3 UTSW 1 37,283,909 (GRCm39) splice site probably benign
R1938:Cnga3 UTSW 1 37,300,954 (GRCm39) missense possibly damaging 0.95
R2968:Cnga3 UTSW 1 37,300,159 (GRCm39) missense probably damaging 1.00
R2969:Cnga3 UTSW 1 37,300,159 (GRCm39) missense probably damaging 1.00
R3406:Cnga3 UTSW 1 37,301,146 (GRCm39) missense probably benign 0.00
R3694:Cnga3 UTSW 1 37,300,821 (GRCm39) missense probably damaging 1.00
R4079:Cnga3 UTSW 1 37,280,946 (GRCm39) missense possibly damaging 0.70
R4850:Cnga3 UTSW 1 37,297,087 (GRCm39) nonsense probably null
R4907:Cnga3 UTSW 1 37,281,023 (GRCm39) critical splice donor site probably null
R5802:Cnga3 UTSW 1 37,300,006 (GRCm39) missense probably damaging 0.98
R6135:Cnga3 UTSW 1 37,271,318 (GRCm39) start gained probably benign
R6586:Cnga3 UTSW 1 37,300,359 (GRCm39) missense probably damaging 0.99
R6997:Cnga3 UTSW 1 37,283,965 (GRCm39) missense probably benign 0.34
R7630:Cnga3 UTSW 1 37,297,127 (GRCm39) missense probably damaging 1.00
R7799:Cnga3 UTSW 1 37,300,852 (GRCm39) missense probably damaging 1.00
R8552:Cnga3 UTSW 1 37,284,060 (GRCm39) missense probably benign
R8859:Cnga3 UTSW 1 37,299,852 (GRCm39) missense possibly damaging 0.91
R8968:Cnga3 UTSW 1 37,300,460 (GRCm39) missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TGATTTCCAACATGAACGCTCCCC -3'
(R):5'- TCCCCAAAGTAACTGCCGTCACTG -3'

Sequencing Primer
(F):5'- GTCAAGCAGTACATGCAGTTC -3'
(R):5'- TAACTGCCGTCACTGAGGAC -3'
Posted On 2014-05-09