Incidental Mutation 'R1678:Zbtb49'
ID 188259
Institutional Source Beutler Lab
Gene Symbol Zbtb49
Ensembl Gene ENSMUSG00000029127
Gene Name zinc finger and BTB domain containing 49
Synonyms Zfp509, 4930518A03Rik
MMRRC Submission 039714-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R1678 (G1)
Quality Score 183
Status Not validated
Chromosome 5
Chromosomal Location 38347076-38377798 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 38371038 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 281 (D281G)
Ref Sequence ENSEMBL: ENSMUSP00000092429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094833] [ENSMUST00000114113] [ENSMUST00000123106] [ENSMUST00000126267] [ENSMUST00000136475] [ENSMUST00000143436] [ENSMUST00000138820]
AlphaFold Q8BXX2
Predicted Effect probably damaging
Transcript: ENSMUST00000094833
AA Change: D281G

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000092429
Gene: ENSMUSG00000029127
AA Change: D281G

DomainStartEndE-ValueType
BTB 25 121 2.97e-23 SMART
ZnF_C2H2 386 408 1.38e-3 SMART
ZnF_C2H2 414 436 6.99e-5 SMART
ZnF_C2H2 442 464 2.24e-3 SMART
ZnF_C2H2 470 492 1.26e-2 SMART
ZnF_C2H2 498 520 5.14e-3 SMART
ZnF_C2H2 526 548 2.27e-4 SMART
ZnF_C2H2 554 576 3.39e-3 SMART
low complexity region 597 614 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114113
AA Change: D281G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109748
Gene: ENSMUSG00000029127
AA Change: D281G

DomainStartEndE-ValueType
BTB 25 121 2.97e-23 SMART
ZnF_C2H2 386 408 1.38e-3 SMART
low complexity region 413 430 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123106
SMART Domains Protein: ENSMUSP00000144200
Gene: ENSMUSG00000029127

DomainStartEndE-ValueType
Pfam:BTB 12 51 1.6e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000126267
AA Change: D281G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000122109
Gene: ENSMUSG00000029127
AA Change: D281G

DomainStartEndE-ValueType
BTB 25 121 2.97e-23 SMART
ZnF_C2H2 386 408 1.38e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129161
Predicted Effect possibly damaging
Transcript: ENSMUST00000136475
AA Change: D281G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117174
Gene: ENSMUSG00000029127
AA Change: D281G

DomainStartEndE-ValueType
BTB 25 121 2.97e-23 SMART
ZnF_C2H2 386 408 1.38e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137577
Predicted Effect probably benign
Transcript: ENSMUST00000143436
SMART Domains Protein: ENSMUSP00000115513
Gene: ENSMUSG00000029127

DomainStartEndE-ValueType
Pfam:BTB 15 75 1.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138820
SMART Domains Protein: ENSMUSP00000117913
Gene: ENSMUSG00000029127

DomainStartEndE-ValueType
Pfam:BTB 13 63 4.3e-12 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A C 17: 24,554,594 (GRCm39) I120S probably benign Het
Abcb5 A C 12: 118,929,064 (GRCm39) probably benign Het
Abcc4 T A 14: 118,832,306 (GRCm39) T775S probably benign Het
Acnat2 T A 4: 49,380,568 (GRCm39) Y270F probably damaging Het
Aif1 G A 17: 35,391,127 (GRCm39) P44L probably benign Het
Ankib1 A G 5: 3,756,301 (GRCm39) I548T probably damaging Het
Apbb1ip A T 2: 22,764,892 (GRCm39) probably null Het
Asb17 C T 3: 153,550,004 (GRCm39) S12F probably damaging Het
Atad2b G A 12: 5,015,899 (GRCm39) V542I possibly damaging Het
Atxn7 T C 14: 14,096,239 (GRCm38) F515L probably damaging Het
Bicc1 A G 10: 70,779,348 (GRCm39) L680P probably damaging Het
Bpifb6 G A 2: 153,750,562 (GRCm39) R351H probably damaging Het
C4b A G 17: 34,962,624 (GRCm39) F26S probably benign Het
Cadps A G 14: 12,517,802 (GRCm38) probably null Het
Capza1 G T 3: 104,771,669 (GRCm39) S9* probably null Het
Ccl11 C T 11: 81,948,866 (GRCm39) P25L probably damaging Het
Cdyl A T 13: 36,040,872 (GRCm39) K306N probably damaging Het
Cnga3 T C 1: 37,300,579 (GRCm39) V471A possibly damaging Het
Col4a4 T C 1: 82,464,380 (GRCm39) K983E unknown Het
Cp A C 3: 20,026,881 (GRCm39) K436N probably damaging Het
Csmd1 T A 8: 15,968,252 (GRCm39) D3125V possibly damaging Het
Daw1 A T 1: 83,161,087 (GRCm39) N143I probably damaging Het
Dmd T A X: 84,018,368 (GRCm39) I3067N probably benign Het
Dnaaf9 A G 2: 130,656,193 (GRCm39) V105A probably damaging Het
Dnah11 T G 12: 117,897,580 (GRCm39) N3550T possibly damaging Het
Dnm2 T C 9: 21,378,828 (GRCm39) V129A possibly damaging Het
Dync1h1 A T 12: 110,632,096 (GRCm39) probably null Het
Dync2i1 A G 12: 116,189,590 (GRCm39) S640P probably damaging Het
Efemp1 G A 11: 28,866,942 (GRCm39) E325K probably benign Het
Enox1 A G 14: 77,815,096 (GRCm39) T85A probably benign Het
Faim2 C A 15: 99,418,217 (GRCm39) V123F possibly damaging Het
Fgfr2 T C 7: 129,830,350 (GRCm39) probably null Het
Fign T C 2: 63,810,718 (GRCm39) E184G probably damaging Het
Fnd3c2 T C X: 105,281,305 (GRCm39) T799A probably benign Het
Frem2 T C 3: 53,427,359 (GRCm39) D2931G probably damaging Het
Fsip2 A G 2: 82,816,689 (GRCm39) T4141A probably benign Het
Gigyf2 T A 1: 87,344,705 (GRCm39) M546K probably benign Het
Gm21775 G A Y: 10,553,867 (GRCm39) V139M probably damaging Het
Gpr83 G T 9: 14,778,145 (GRCm39) V172F probably damaging Het
Itprid1 G T 6: 55,945,499 (GRCm39) C740F probably benign Het
Jmjd4 A G 11: 59,344,438 (GRCm39) Y179C probably damaging Het
Kcnq3 A G 15: 65,903,281 (GRCm39) L143P probably damaging Het
Klhl41 T C 2: 69,501,283 (GRCm39) V248A probably benign Het
Lama1 T C 17: 68,117,150 (GRCm39) Y2482H possibly damaging Het
Lamb2 A T 9: 108,360,885 (GRCm39) probably null Het
Lclat1 G A 17: 73,503,715 (GRCm39) G162R probably damaging Het
Map6 T C 7: 98,917,305 (GRCm39) V26A probably damaging Het
Mdn1 A T 4: 32,663,050 (GRCm39) D107V probably damaging Het
Metap1d T A 2: 71,355,121 (GRCm39) V304D possibly damaging Het
Naca A G 10: 127,879,395 (GRCm39) probably benign Het
Napg T C 18: 63,117,143 (GRCm39) probably null Het
Nbeal1 T A 1: 60,299,493 (GRCm39) F7L probably benign Het
Ndst2 T C 14: 20,774,582 (GRCm39) T825A probably benign Het
Nsun2 T C 13: 69,775,222 (GRCm39) I353T probably damaging Het
Nt5c3b T A 11: 100,327,036 (GRCm39) I87F probably damaging Het
Nxf3 T C X: 134,976,270 (GRCm39) D407G probably damaging Het
Or51f2 T A 7: 102,526,870 (GRCm39) V181E probably damaging Het
Or8c13 A T 9: 38,091,933 (GRCm39) F62Y possibly damaging Het
Osbpl3 A C 6: 50,313,193 (GRCm39) probably null Het
P2rx3 T C 2: 84,852,811 (GRCm39) T172A possibly damaging Het
Pcdh10 G T 3: 45,336,316 (GRCm39) E877* probably null Het
Pcdhb9 A T 18: 37,534,682 (GRCm39) K225N probably damaging Het
Plch1 A G 3: 63,648,115 (GRCm39) S419P probably damaging Het
Prex2 T G 1: 11,355,313 (GRCm39) I1538S possibly damaging Het
Prss59 C A 6: 40,906,453 (GRCm39) probably benign Het
Rasl10a A G 11: 5,009,815 (GRCm39) E121G possibly damaging Het
Rbbp8 A G 18: 11,865,372 (GRCm39) T754A probably benign Het
Rictor T C 15: 6,785,952 (GRCm39) V156A probably benign Het
Ryr1 A T 7: 28,815,579 (GRCm39) Y104N probably damaging Het
Sctr G T 1: 119,964,169 (GRCm39) probably null Het
Sptbn2 T C 19: 4,800,525 (GRCm39) Y2247H probably damaging Het
Sqle C T 15: 59,196,358 (GRCm39) R384W probably damaging Het
Srcin1 C A 11: 97,409,470 (GRCm39) R1163L probably damaging Het
Srp72 A G 5: 77,128,154 (GRCm39) Y125C probably damaging Het
Srrm2 T C 17: 24,037,960 (GRCm39) S1535P probably benign Het
Sumf2 A G 5: 129,883,557 (GRCm39) E125G possibly damaging Het
Tas2r144 A T 6: 42,192,490 (GRCm39) I77F probably benign Het
Tcerg1 T C 18: 42,657,414 (GRCm39) S299P unknown Het
Tcp1 T A 17: 13,139,310 (GRCm39) N212K probably benign Het
Ttc7 G T 17: 87,669,329 (GRCm39) G659C probably damaging Het
Ttn A T 2: 76,691,903 (GRCm39) probably null Het
Ubtf A T 11: 102,199,804 (GRCm39) D440E probably benign Het
Usp30 A G 5: 114,259,207 (GRCm39) D428G probably damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,578,962 (GRCm39) probably benign Het
Vmn2r58 G A 7: 41,513,480 (GRCm39) H388Y probably benign Het
Zfp248 A G 6: 118,406,765 (GRCm39) S174P probably benign Het
Zswim9 T C 7: 13,011,337 (GRCm39) T4A probably benign Het
Other mutations in Zbtb49
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01355:Zbtb49 APN 5 38,367,960 (GRCm39) critical splice donor site probably null
IGL01736:Zbtb49 APN 5 38,358,204 (GRCm39) missense probably damaging 1.00
PIT4585001:Zbtb49 UTSW 5 38,373,820 (GRCm39) missense probably damaging 1.00
R0443:Zbtb49 UTSW 5 38,358,174 (GRCm39) missense probably benign 0.08
R0526:Zbtb49 UTSW 5 38,371,263 (GRCm39) missense probably benign 0.08
R0646:Zbtb49 UTSW 5 38,358,018 (GRCm39) missense probably damaging 1.00
R1200:Zbtb49 UTSW 5 38,370,675 (GRCm39) missense probably damaging 1.00
R1964:Zbtb49 UTSW 5 38,361,105 (GRCm39) nonsense probably null
R2155:Zbtb49 UTSW 5 38,371,464 (GRCm39) missense possibly damaging 0.86
R2483:Zbtb49 UTSW 5 38,360,701 (GRCm39) intron probably benign
R3617:Zbtb49 UTSW 5 38,357,975 (GRCm39) unclassified probably benign
R4937:Zbtb49 UTSW 5 38,371,307 (GRCm39) missense possibly damaging 0.76
R5579:Zbtb49 UTSW 5 38,358,160 (GRCm39) missense probably damaging 0.99
R5699:Zbtb49 UTSW 5 38,373,870 (GRCm39) missense probably damaging 1.00
R6354:Zbtb49 UTSW 5 38,360,903 (GRCm39) missense possibly damaging 0.58
R6426:Zbtb49 UTSW 5 38,360,431 (GRCm39) splice site probably null
R6735:Zbtb49 UTSW 5 38,358,402 (GRCm39) missense possibly damaging 0.74
R6805:Zbtb49 UTSW 5 38,370,585 (GRCm39) intron probably benign
R6869:Zbtb49 UTSW 5 38,371,694 (GRCm39) missense probably damaging 1.00
R7020:Zbtb49 UTSW 5 38,370,711 (GRCm39) nonsense probably null
R7899:Zbtb49 UTSW 5 38,371,274 (GRCm39) nonsense probably null
R8041:Zbtb49 UTSW 5 38,358,198 (GRCm39) missense possibly damaging 0.61
R8461:Zbtb49 UTSW 5 38,358,453 (GRCm39) missense probably benign 0.04
R8517:Zbtb49 UTSW 5 38,357,997 (GRCm39) missense probably benign 0.25
R8523:Zbtb49 UTSW 5 38,370,669 (GRCm39) missense probably damaging 1.00
R9068:Zbtb49 UTSW 5 38,358,289 (GRCm39) missense probably benign
R9160:Zbtb49 UTSW 5 38,363,246 (GRCm39) missense probably damaging 0.99
R9301:Zbtb49 UTSW 5 38,370,931 (GRCm39) missense probably benign
R9315:Zbtb49 UTSW 5 38,358,082 (GRCm39) missense probably benign 0.05
R9480:Zbtb49 UTSW 5 38,358,409 (GRCm39) missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- GCATCTTCCTTAGCAGCAGACTCC -3'
(R):5'- TCGGCAAATTTCAGTCGTCCCAC -3'

Sequencing Primer
(F):5'- TAGCAGCAGACTCCTCCCTC -3'
(R):5'- ATTTCAGTCGTCCCACGGAAG -3'
Posted On 2014-05-09