Incidental Mutation 'R1678:Sumf2'
ID 188262
Institutional Source Beutler Lab
Gene Symbol Sumf2
Ensembl Gene ENSMUSG00000025538
Gene Name sulfatase modifying factor 2
Synonyms 2610040F05Rik
MMRRC Submission 039714-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.107) question?
Stock # R1678 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 129875807-129892275 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 129883557 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 125 (E125G)
Ref Sequence ENSEMBL: ENSMUSP00000144230 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000137357] [ENSMUST00000171300] [ENSMUST00000201874]
AlphaFold Q8BPG6
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122826
Predicted Effect probably benign
Transcript: ENSMUST00000137357
AA Change: R151G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000144155
Gene: ENSMUSG00000025538
AA Change: R151G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:FGE-sulfatase 25 136 6.2e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153063
Predicted Effect probably benign
Transcript: ENSMUST00000171300
AA Change: E145G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000126036
Gene: ENSMUSG00000025538
AA Change: E145G

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:FGE-sulfatase 34 299 3.9e-88 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201029
Predicted Effect possibly damaging
Transcript: ENSMUST00000201874
AA Change: E125G

PolyPhen 2 Score 0.694 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000144230
Gene: ENSMUSG00000025538
AA Change: E125G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:FGE-sulfatase 29 135 3.5e-22 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The catalytic sites of sulfatases are only active if they contain a unique amino acid, C-alpha-formylglycine (FGly). The FGly residue is posttranslationally generated from a cysteine by enzymes with FGly-generating activity. The gene described in this record is a member of the sulfatase-modifying factor family and encodes a protein with a DUF323 domain that localizes to the lumen of the endoplasmic reticulum. This protein has low levels of FGly-generating activity but can heterodimerize with another family member - a protein with high levels of FGly-generating activity. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A C 17: 24,554,594 (GRCm39) I120S probably benign Het
Abcb5 A C 12: 118,929,064 (GRCm39) probably benign Het
Abcc4 T A 14: 118,832,306 (GRCm39) T775S probably benign Het
Acnat2 T A 4: 49,380,568 (GRCm39) Y270F probably damaging Het
Aif1 G A 17: 35,391,127 (GRCm39) P44L probably benign Het
Ankib1 A G 5: 3,756,301 (GRCm39) I548T probably damaging Het
Apbb1ip A T 2: 22,764,892 (GRCm39) probably null Het
Asb17 C T 3: 153,550,004 (GRCm39) S12F probably damaging Het
Atad2b G A 12: 5,015,899 (GRCm39) V542I possibly damaging Het
Atxn7 T C 14: 14,096,239 (GRCm38) F515L probably damaging Het
Bicc1 A G 10: 70,779,348 (GRCm39) L680P probably damaging Het
Bpifb6 G A 2: 153,750,562 (GRCm39) R351H probably damaging Het
C4b A G 17: 34,962,624 (GRCm39) F26S probably benign Het
Cadps A G 14: 12,517,802 (GRCm38) probably null Het
Capza1 G T 3: 104,771,669 (GRCm39) S9* probably null Het
Ccl11 C T 11: 81,948,866 (GRCm39) P25L probably damaging Het
Cdyl A T 13: 36,040,872 (GRCm39) K306N probably damaging Het
Cnga3 T C 1: 37,300,579 (GRCm39) V471A possibly damaging Het
Col4a4 T C 1: 82,464,380 (GRCm39) K983E unknown Het
Cp A C 3: 20,026,881 (GRCm39) K436N probably damaging Het
Csmd1 T A 8: 15,968,252 (GRCm39) D3125V possibly damaging Het
Daw1 A T 1: 83,161,087 (GRCm39) N143I probably damaging Het
Dmd T A X: 84,018,368 (GRCm39) I3067N probably benign Het
Dnaaf9 A G 2: 130,656,193 (GRCm39) V105A probably damaging Het
Dnah11 T G 12: 117,897,580 (GRCm39) N3550T possibly damaging Het
Dnm2 T C 9: 21,378,828 (GRCm39) V129A possibly damaging Het
Dync1h1 A T 12: 110,632,096 (GRCm39) probably null Het
Dync2i1 A G 12: 116,189,590 (GRCm39) S640P probably damaging Het
Efemp1 G A 11: 28,866,942 (GRCm39) E325K probably benign Het
Enox1 A G 14: 77,815,096 (GRCm39) T85A probably benign Het
Faim2 C A 15: 99,418,217 (GRCm39) V123F possibly damaging Het
Fgfr2 T C 7: 129,830,350 (GRCm39) probably null Het
Fign T C 2: 63,810,718 (GRCm39) E184G probably damaging Het
Fnd3c2 T C X: 105,281,305 (GRCm39) T799A probably benign Het
Frem2 T C 3: 53,427,359 (GRCm39) D2931G probably damaging Het
Fsip2 A G 2: 82,816,689 (GRCm39) T4141A probably benign Het
Gigyf2 T A 1: 87,344,705 (GRCm39) M546K probably benign Het
Gm21775 G A Y: 10,553,867 (GRCm39) V139M probably damaging Het
Gpr83 G T 9: 14,778,145 (GRCm39) V172F probably damaging Het
Itprid1 G T 6: 55,945,499 (GRCm39) C740F probably benign Het
Jmjd4 A G 11: 59,344,438 (GRCm39) Y179C probably damaging Het
Kcnq3 A G 15: 65,903,281 (GRCm39) L143P probably damaging Het
Klhl41 T C 2: 69,501,283 (GRCm39) V248A probably benign Het
Lama1 T C 17: 68,117,150 (GRCm39) Y2482H possibly damaging Het
Lamb2 A T 9: 108,360,885 (GRCm39) probably null Het
Lclat1 G A 17: 73,503,715 (GRCm39) G162R probably damaging Het
Map6 T C 7: 98,917,305 (GRCm39) V26A probably damaging Het
Mdn1 A T 4: 32,663,050 (GRCm39) D107V probably damaging Het
Metap1d T A 2: 71,355,121 (GRCm39) V304D possibly damaging Het
Naca A G 10: 127,879,395 (GRCm39) probably benign Het
Napg T C 18: 63,117,143 (GRCm39) probably null Het
Nbeal1 T A 1: 60,299,493 (GRCm39) F7L probably benign Het
Ndst2 T C 14: 20,774,582 (GRCm39) T825A probably benign Het
Nsun2 T C 13: 69,775,222 (GRCm39) I353T probably damaging Het
Nt5c3b T A 11: 100,327,036 (GRCm39) I87F probably damaging Het
Nxf3 T C X: 134,976,270 (GRCm39) D407G probably damaging Het
Or51f2 T A 7: 102,526,870 (GRCm39) V181E probably damaging Het
Or8c13 A T 9: 38,091,933 (GRCm39) F62Y possibly damaging Het
Osbpl3 A C 6: 50,313,193 (GRCm39) probably null Het
P2rx3 T C 2: 84,852,811 (GRCm39) T172A possibly damaging Het
Pcdh10 G T 3: 45,336,316 (GRCm39) E877* probably null Het
Pcdhb9 A T 18: 37,534,682 (GRCm39) K225N probably damaging Het
Plch1 A G 3: 63,648,115 (GRCm39) S419P probably damaging Het
Prex2 T G 1: 11,355,313 (GRCm39) I1538S possibly damaging Het
Prss59 C A 6: 40,906,453 (GRCm39) probably benign Het
Rasl10a A G 11: 5,009,815 (GRCm39) E121G possibly damaging Het
Rbbp8 A G 18: 11,865,372 (GRCm39) T754A probably benign Het
Rictor T C 15: 6,785,952 (GRCm39) V156A probably benign Het
Ryr1 A T 7: 28,815,579 (GRCm39) Y104N probably damaging Het
Sctr G T 1: 119,964,169 (GRCm39) probably null Het
Sptbn2 T C 19: 4,800,525 (GRCm39) Y2247H probably damaging Het
Sqle C T 15: 59,196,358 (GRCm39) R384W probably damaging Het
Srcin1 C A 11: 97,409,470 (GRCm39) R1163L probably damaging Het
Srp72 A G 5: 77,128,154 (GRCm39) Y125C probably damaging Het
Srrm2 T C 17: 24,037,960 (GRCm39) S1535P probably benign Het
Tas2r144 A T 6: 42,192,490 (GRCm39) I77F probably benign Het
Tcerg1 T C 18: 42,657,414 (GRCm39) S299P unknown Het
Tcp1 T A 17: 13,139,310 (GRCm39) N212K probably benign Het
Ttc7 G T 17: 87,669,329 (GRCm39) G659C probably damaging Het
Ttn A T 2: 76,691,903 (GRCm39) probably null Het
Ubtf A T 11: 102,199,804 (GRCm39) D440E probably benign Het
Usp30 A G 5: 114,259,207 (GRCm39) D428G probably damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,578,962 (GRCm39) probably benign Het
Vmn2r58 G A 7: 41,513,480 (GRCm39) H388Y probably benign Het
Zbtb49 T C 5: 38,371,038 (GRCm39) D281G probably damaging Het
Zfp248 A G 6: 118,406,765 (GRCm39) S174P probably benign Het
Zswim9 T C 7: 13,011,337 (GRCm39) T4A probably benign Het
Other mutations in Sumf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Sumf2 APN 5 129,882,918 (GRCm39) intron probably benign
IGL01285:Sumf2 APN 5 129,878,811 (GRCm39) missense probably damaging 1.00
IGL02247:Sumf2 APN 5 129,888,986 (GRCm39) missense probably damaging 0.98
IGL02348:Sumf2 APN 5 129,888,711 (GRCm39) missense probably damaging 1.00
IGL03074:Sumf2 APN 5 129,888,674 (GRCm39) splice site probably benign
R0105:Sumf2 UTSW 5 129,878,735 (GRCm39) splice site probably benign
R0105:Sumf2 UTSW 5 129,878,735 (GRCm39) splice site probably benign
R0751:Sumf2 UTSW 5 129,878,846 (GRCm39) missense probably benign 0.45
R1219:Sumf2 UTSW 5 129,883,613 (GRCm39) missense probably benign
R1565:Sumf2 UTSW 5 129,888,755 (GRCm39) missense probably damaging 1.00
R1778:Sumf2 UTSW 5 129,873,909 (GRCm39) unclassified probably benign
R2987:Sumf2 UTSW 5 129,875,925 (GRCm39) missense possibly damaging 0.96
R3930:Sumf2 UTSW 5 129,878,820 (GRCm39) missense probably benign 0.15
R6877:Sumf2 UTSW 5 129,878,867 (GRCm39) missense probably damaging 1.00
R7060:Sumf2 UTSW 5 129,883,341 (GRCm39) missense possibly damaging 0.66
R7326:Sumf2 UTSW 5 129,891,551 (GRCm39) missense probably benign 0.00
R7949:Sumf2 UTSW 5 129,881,759 (GRCm39) missense probably damaging 1.00
R8291:Sumf2 UTSW 5 129,887,138 (GRCm39) critical splice donor site probably null
R8356:Sumf2 UTSW 5 129,889,003 (GRCm39) missense possibly damaging 0.84
R8456:Sumf2 UTSW 5 129,889,003 (GRCm39) missense possibly damaging 0.84
R9185:Sumf2 UTSW 5 129,875,909 (GRCm39) missense possibly damaging 0.53
R9649:Sumf2 UTSW 5 129,891,482 (GRCm39) missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GGCTTCCCTAAACCCGTAACTTGTC -3'
(R):5'- TCCTTTCAAGCCAGTGCAGGAC -3'

Sequencing Primer
(F):5'- tcctccttcctcaaccttcc -3'
(R):5'- CCAGTGCAGGACAGGGC -3'
Posted On 2014-05-09