Incidental Mutation 'R1678:Lamb2'
ID188282
Institutional Source Beutler Lab
Gene Symbol Lamb2
Ensembl Gene ENSMUSG00000052911
Gene Namelaminin, beta 2
SynonymsLams, npht, Lamb-2
MMRRC Submission 039714-MU
Accession Numbers

Genbank: NM_008483; MGI: 99916

Is this an essential gene? Probably essential (E-score: 0.806) question?
Stock #R1678 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location108479736-108490530 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 108483686 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000069087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065014] [ENSMUST00000194147] [ENSMUST00000195058] [ENSMUST00000195483]
Predicted Effect probably null
Transcript: ENSMUST00000065014
SMART Domains Protein: ENSMUSP00000069087
Gene: ENSMUSG00000052911

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
LamNT 44 284 1.9e-102 SMART
EGF_Lam 286 347 1.34e-6 SMART
EGF_Lam 350 410 6.1e-10 SMART
EGF_Lam 413 470 2.98e-13 SMART
EGF_Lam 473 522 7.93e-9 SMART
EGF_Lam 525 569 1.01e-10 SMART
EGF_Lam 784 829 3.42e-13 SMART
EGF_Lam 832 875 6.54e-10 SMART
EGF_Lam 878 925 1.34e-6 SMART
EGF_Lam 928 984 4.74e-7 SMART
EGF_Lam 987 1036 1.53e-10 SMART
EGF_Lam 1039 1093 6.29e-12 SMART
EGF_Lam 1096 1141 1.79e-7 SMART
EGF_Lam 1144 1188 6.64e-11 SMART
coiled coil region 1261 1299 N/A INTRINSIC
low complexity region 1445 1458 N/A INTRINSIC
coiled coil region 1473 1527 N/A INTRINSIC
low complexity region 1609 1625 N/A INTRINSIC
SCOP:d1eq1a_ 1632 1786 5e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191864
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193301
Predicted Effect probably benign
Transcript: ENSMUST00000194147
SMART Domains Protein: ENSMUSP00000141562
Gene: ENSMUSG00000052911

DomainStartEndE-ValueType
low complexity region 59 79 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195058
SMART Domains Protein: ENSMUSP00000141757
Gene: ENSMUSG00000052911

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Pfam:Laminin_N 50 102 6.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195483
SMART Domains Protein: ENSMUSP00000142304
Gene: ENSMUSG00000052911

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
LamNT 44 125 3e-3 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype Strain: 2138070
Lethality: D1-D30
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the beta chain isoform laminin, beta 2. The beta 2 chain contains the 7 structural domains typical of beta chains of laminin, including the short alpha region. However, unlike beta 1 chain, beta 2 has a more restricted tissue distribution. It is enriched in the basement membrane of muscles at the neuromuscular junctions, kidney glomerulus and vascular smooth muscle. Transgenic mice in which the beta 2 chain gene was inactivated by homologous recombination, showed defects in the maturation of neuromuscular junctions and impairment of glomerular filtration. Alternative splicing involving a non consensus 5' splice site (gc) in the 5' UTR of this gene has been reported. It was suggested that inefficient splicing of this first intron, which does not change the protein sequence, results in a greater abundance of the unspliced form of the transcript than the spliced form. The full-length nature of the spliced transcript is not known. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit small size, severe proteinuria due to a defect in glomerular filtration, abnormalities of the retina and skeletal neuromuscular synapses, and lethality by 30 days of age. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(2) Gene trapped(3)

Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik C A 6: 40,929,519 probably benign Het
4930402H24Rik A G 2: 130,814,273 V105A probably damaging Het
Abca17 A C 17: 24,335,620 I120S probably benign Het
Abcb5 A C 12: 118,965,329 probably benign Het
Abcc4 T A 14: 118,594,894 T775S probably benign Het
Acnat2 T A 4: 49,380,568 Y270F probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Ankib1 A G 5: 3,706,301 I548T probably damaging Het
Apbb1ip A T 2: 22,874,880 probably null Het
Asb17 C T 3: 153,844,367 S12F probably damaging Het
Atad2b G A 12: 4,965,899 V542I possibly damaging Het
Atxn7 T C 14: 14,096,239 F515L probably damaging Het
Bicc1 A G 10: 70,943,518 L680P probably damaging Het
Bpifb6 G A 2: 153,908,642 R351H probably damaging Het
C4b A G 17: 34,743,650 F26S probably benign Het
Cadps A G 14: 12,517,802 probably null Het
Capza1 G T 3: 104,864,353 S9* probably null Het
Ccdc129 G T 6: 55,968,514 C740F probably benign Het
Ccl11 C T 11: 82,058,040 P25L probably damaging Het
Cdyl A T 13: 35,856,889 K306N probably damaging Het
Cnga3 T C 1: 37,261,498 V471A possibly damaging Het
Col4a4 T C 1: 82,486,659 K983E unknown Het
Cp A C 3: 19,972,717 K436N probably damaging Het
Csmd1 T A 8: 15,918,252 D3125V possibly damaging Het
Daw1 A T 1: 83,183,366 N143I probably damaging Het
Dmd T A X: 84,974,762 I3067N probably benign Het
Dnah11 T G 12: 117,933,845 N3550T possibly damaging Het
Dnm2 T C 9: 21,467,532 V129A possibly damaging Het
Dync1h1 A T 12: 110,665,662 probably null Het
Efemp1 G A 11: 28,916,942 E325K probably benign Het
Enox1 A G 14: 77,577,656 T85A probably benign Het
Faim2 C A 15: 99,520,336 V123F possibly damaging Het
Fgfr2 T C 7: 130,228,620 probably null Het
Fign T C 2: 63,980,374 E184G probably damaging Het
Fnd3c2 T C X: 106,237,699 T799A probably benign Het
Frem2 T C 3: 53,519,938 D2931G probably damaging Het
Fsip2 A G 2: 82,986,345 T4141A probably benign Het
Gigyf2 T A 1: 87,416,983 M546K probably benign Het
Gm21775 G A Y: 10,553,867 V139M probably damaging Het
Gpr83 G T 9: 14,866,849 V172F probably damaging Het
Jmjd4 A G 11: 59,453,612 Y179C probably damaging Het
Kcnq3 A G 15: 66,031,432 L143P probably damaging Het
Klhl41 T C 2: 69,670,939 V248A probably benign Het
Lama1 T C 17: 67,810,155 Y2482H possibly damaging Het
Lclat1 G A 17: 73,196,720 G162R probably damaging Het
Map6 T C 7: 99,268,098 V26A probably damaging Het
Mdn1 A T 4: 32,663,050 D107V probably damaging Het
Metap1d T A 2: 71,524,777 V304D possibly damaging Het
Naca A G 10: 128,043,526 probably benign Het
Napg T C 18: 62,984,072 probably null Het
Nbeal1 T A 1: 60,260,334 F7L probably benign Het
Ndst2 T C 14: 20,724,514 T825A probably benign Het
Nsun2 T C 13: 69,627,103 I353T probably damaging Het
Nt5c3b T A 11: 100,436,210 I87F probably damaging Het
Nxf3 T C X: 136,075,521 D407G probably damaging Het
Olfr568 T A 7: 102,877,663 V181E probably damaging Het
Olfr891 A T 9: 38,180,637 F62Y possibly damaging Het
Osbpl3 A C 6: 50,336,213 probably null Het
P2rx3 T C 2: 85,022,467 T172A possibly damaging Het
Pcdh10 G T 3: 45,381,881 E877* probably null Het
Pcdhb9 A T 18: 37,401,629 K225N probably damaging Het
Plch1 A G 3: 63,740,694 S419P probably damaging Het
Prex2 T G 1: 11,285,089 I1538S possibly damaging Het
Rasl10a A G 11: 5,059,815 E121G possibly damaging Het
Rbbp8 A G 18: 11,732,315 T754A probably benign Het
Rictor T C 15: 6,756,471 V156A probably benign Het
Ryr1 A T 7: 29,116,154 Y104N probably damaging Het
Sctr G T 1: 120,036,439 probably null Het
Sptbn2 T C 19: 4,750,497 Y2247H probably damaging Het
Sqle C T 15: 59,324,509 R384W probably damaging Het
Srcin1 C A 11: 97,518,644 R1163L probably damaging Het
Srp72 A G 5: 76,980,307 Y125C probably damaging Het
Srrm2 T C 17: 23,818,986 S1535P probably benign Het
Sumf2 A G 5: 129,854,716 E125G possibly damaging Het
Tas2r144 A T 6: 42,215,556 I77F probably benign Het
Tcerg1 T C 18: 42,524,349 S299P unknown Het
Tcp1 T A 17: 12,920,423 N212K probably benign Het
Ttc7 G T 17: 87,361,901 G659C probably damaging Het
Ttn A T 2: 76,861,559 probably null Het
Ubtf A T 11: 102,308,978 D440E probably benign Het
Usp30 A G 5: 114,121,146 D428G probably damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Vmn2r58 G A 7: 41,864,056 H388Y probably benign Het
Wdr60 A G 12: 116,225,970 S640P probably damaging Het
Zbtb49 T C 5: 38,213,694 D281G probably damaging Het
Zfp248 A G 6: 118,429,804 S174P probably benign Het
Zswim9 T C 7: 13,277,411 T4A probably benign Het
Other mutations in Lamb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01370:Lamb2 APN 9 108487733 unclassified probably null
IGL02072:Lamb2 APN 9 108481908 nonsense probably null
IGL02079:Lamb2 APN 9 108482113 missense probably damaging 1.00
IGL02087:Lamb2 APN 9 108487119 missense possibly damaging 0.95
IGL02193:Lamb2 APN 9 108489360 missense probably benign 0.00
IGL02199:Lamb2 APN 9 108480625 missense possibly damaging 0.49
IGL02201:Lamb2 APN 9 108487542 missense probably damaging 1.00
IGL02468:Lamb2 APN 9 108487149 missense probably damaging 1.00
F6893:Lamb2 UTSW 9 108482556 missense probably benign 0.12
R0053:Lamb2 UTSW 9 108486737 nonsense probably null
R0053:Lamb2 UTSW 9 108486737 nonsense probably null
R0122:Lamb2 UTSW 9 108486514 missense probably benign 0.01
R0452:Lamb2 UTSW 9 108486354 unclassified probably benign
R0524:Lamb2 UTSW 9 108484372 missense possibly damaging 0.90
R0605:Lamb2 UTSW 9 108486105 unclassified probably benign
R0737:Lamb2 UTSW 9 108483794 missense probably benign 0.03
R1083:Lamb2 UTSW 9 108483693 missense probably benign
R1159:Lamb2 UTSW 9 108481408 missense probably damaging 1.00
R1283:Lamb2 UTSW 9 108481808 missense possibly damaging 0.46
R1507:Lamb2 UTSW 9 108490382 missense probably damaging 1.00
R1547:Lamb2 UTSW 9 108482625 missense probably benign 0.00
R1576:Lamb2 UTSW 9 108480307 missense probably damaging 0.96
R1647:Lamb2 UTSW 9 108481423 critical splice donor site probably null
R1740:Lamb2 UTSW 9 108481928 missense probably damaging 1.00
R1803:Lamb2 UTSW 9 108488099 missense probably benign
R1846:Lamb2 UTSW 9 108487387 missense probably benign 0.00
R1863:Lamb2 UTSW 9 108481384 missense probably benign 0.13
R2184:Lamb2 UTSW 9 108480553 missense probably damaging 1.00
R2262:Lamb2 UTSW 9 108480610 missense probably damaging 1.00
R2338:Lamb2 UTSW 9 108482141 missense probably benign 0.20
R2483:Lamb2 UTSW 9 108480559 missense probably damaging 1.00
R4084:Lamb2 UTSW 9 108488018 missense probably benign 0.17
R4164:Lamb2 UTSW 9 108490298 missense probably damaging 1.00
R4295:Lamb2 UTSW 9 108486211 missense probably benign 0.42
R4422:Lamb2 UTSW 9 108483555 missense probably damaging 0.99
R4497:Lamb2 UTSW 9 108486798 missense probably damaging 1.00
R4880:Lamb2 UTSW 9 108484027 unclassified probably null
R4935:Lamb2 UTSW 9 108487501 missense possibly damaging 0.93
R4977:Lamb2 UTSW 9 108487647 missense probably damaging 0.99
R5152:Lamb2 UTSW 9 108487738 missense probably benign
R5499:Lamb2 UTSW 9 108487802 missense possibly damaging 0.50
R5724:Lamb2 UTSW 9 108480751 splice site probably null
R5932:Lamb2 UTSW 9 108480611 missense probably damaging 1.00
R5997:Lamb2 UTSW 9 108480388 missense possibly damaging 0.65
R6052:Lamb2 UTSW 9 108487612 nonsense probably null
R6142:Lamb2 UTSW 9 108485618 nonsense probably null
R6245:Lamb2 UTSW 9 108488199 splice site probably null
R6531:Lamb2 UTSW 9 108483726 missense possibly damaging 0.78
R6557:Lamb2 UTSW 9 108488400 missense probably damaging 1.00
R6562:Lamb2 UTSW 9 108487008 missense possibly damaging 0.56
R6997:Lamb2 UTSW 9 108481297 missense probably damaging 1.00
R7024:Lamb2 UTSW 9 108489488 missense probably benign 0.00
R7116:Lamb2 UTSW 9 108487323 missense probably damaging 1.00
R7146:Lamb2 UTSW 9 108484084 missense possibly damaging 0.94
R7261:Lamb2 UTSW 9 108481297 missense probably damaging 1.00
R7288:Lamb2 UTSW 9 108488324 missense probably benign 0.20
R7404:Lamb2 UTSW 9 108487583 missense probably damaging 1.00
R7456:Lamb2 UTSW 9 108485780 missense possibly damaging 0.95
R7472:Lamb2 UTSW 9 108486148 missense probably benign 0.01
R7623:Lamb2 UTSW 9 108489224 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- GTCAGTGGTAAATGCTGGACTCCC -3'
(R):5'- GCCCCTGAGTCAATGCAGTCAAAG -3'

Sequencing Primer
(F):5'- CAAGGAGGTCTGTTCCTGGC -3'
(R):5'- TGTCAGGTGAACCACTGTC -3'
Posted On2014-05-09