Incidental Mutation 'R1678:Ubtf'
ID188292
Institutional Source Beutler Lab
Gene Symbol Ubtf
Ensembl Gene ENSMUSG00000020923
Gene Nameupstream binding transcription factor, RNA polymerase I
SynonymsA930005G04Rik, UBF1, Tcfubf, UBF
MMRRC Submission 039714-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1678 (G1)
Quality Score148
Status Not validated
Chromosome11
Chromosomal Location102304560-102319742 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 102308978 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 440 (D440E)
Ref Sequence ENSEMBL: ENSMUSP00000006754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006754] [ENSMUST00000079589] [ENSMUST00000107115] [ENSMUST00000107117] [ENSMUST00000107119] [ENSMUST00000107123] [ENSMUST00000128016] [ENSMUST00000146896] [ENSMUST00000173870] [ENSMUST00000174302] [ENSMUST00000178839]
Predicted Effect probably benign
Transcript: ENSMUST00000006754
AA Change: D440E

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000006754
Gene: ENSMUSG00000020923
AA Change: D440E

DomainStartEndE-ValueType
Blast:SANT 18 78 6e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 260 326 1.1e-14 SMART
HMG 369 439 6.29e-19 SMART
HMG 444 513 4.74e-5 SMART
HMG 530 598 2.54e-14 SMART
low complexity region 640 661 N/A INTRINSIC
low complexity region 677 705 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079589
AA Change: D477E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000078539
Gene: ENSMUSG00000020923
AA Change: D477E

DomainStartEndE-ValueType
Blast:SANT 18 78 8e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 195 265 1.95e-15 SMART
HMG 297 363 1.1e-14 SMART
HMG 406 476 6.29e-19 SMART
HMG 481 550 4.74e-5 SMART
HMG 567 635 2.54e-14 SMART
low complexity region 675 763 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107115
AA Change: D440E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000102732
Gene: ENSMUSG00000020923
AA Change: D440E

DomainStartEndE-ValueType
Blast:SANT 18 78 8e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 260 326 1.1e-14 SMART
HMG 369 439 6.29e-19 SMART
HMG 444 513 4.74e-5 SMART
HMG 530 598 2.54e-14 SMART
low complexity region 638 726 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107117
AA Change: D440E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000102734
Gene: ENSMUSG00000020923
AA Change: D440E

DomainStartEndE-ValueType
Blast:SANT 18 78 8e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 260 326 1.1e-14 SMART
HMG 369 439 6.29e-19 SMART
HMG 444 513 4.74e-5 SMART
HMG 530 598 2.54e-14 SMART
low complexity region 638 726 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107119
AA Change: D440E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000102736
Gene: ENSMUSG00000020923
AA Change: D440E

DomainStartEndE-ValueType
Blast:SANT 18 78 8e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 260 326 1.1e-14 SMART
HMG 369 439 6.29e-19 SMART
HMG 444 513 4.74e-5 SMART
HMG 530 598 2.54e-14 SMART
low complexity region 638 726 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107123
AA Change: D477E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102740
Gene: ENSMUSG00000020923
AA Change: D477E

DomainStartEndE-ValueType
Blast:SANT 18 78 8e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 195 265 1.95e-15 SMART
HMG 297 363 1.1e-14 SMART
HMG 406 476 6.29e-19 SMART
HMG 481 550 4.74e-5 SMART
HMG 567 635 2.54e-14 SMART
low complexity region 675 763 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128016
SMART Domains Protein: ENSMUSP00000131930
Gene: ENSMUSG00000020923

DomainStartEndE-ValueType
Blast:SANT 18 78 2e-34 BLAST
HMG 111 169 1.15e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146896
SMART Domains Protein: ENSMUSP00000134665
Gene: ENSMUSG00000020923

DomainStartEndE-ValueType
Blast:SANT 18 78 1e-34 BLAST
HMG 83 151 2.09e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173870
AA Change: D477E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000133611
Gene: ENSMUSG00000020923
AA Change: D477E

DomainStartEndE-ValueType
Blast:SANT 18 78 8e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 195 265 1.95e-15 SMART
HMG 297 363 1.1e-14 SMART
HMG 406 476 6.29e-19 SMART
HMG 481 550 4.74e-5 SMART
HMG 567 635 2.54e-14 SMART
low complexity region 675 763 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174302
AA Change: D477E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000133844
Gene: ENSMUSG00000020923
AA Change: D477E

DomainStartEndE-ValueType
Blast:SANT 18 78 8e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 195 265 1.95e-15 SMART
HMG 297 363 1.1e-14 SMART
HMG 406 476 6.29e-19 SMART
HMG 481 550 4.74e-5 SMART
HMG 567 635 2.54e-14 SMART
low complexity region 675 763 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174726
Predicted Effect probably benign
Transcript: ENSMUST00000178839
AA Change: D440E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000136310
Gene: ENSMUSG00000020923
AA Change: D440E

DomainStartEndE-ValueType
Blast:SANT 18 78 8e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 260 326 1.1e-14 SMART
HMG 369 439 6.29e-19 SMART
HMG 444 513 4.74e-5 SMART
HMG 530 598 2.54e-14 SMART
low complexity region 638 726 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the HMG-box DNA-binding protein family. The encoded protein plays a critical role in ribosomal RNA transcription as a key component of the pre-initiation complex, mediating the recruitment of RNA polymerase I to rDNA promoter regions. The encoded protein may also play important roles in chromatin remodeling and pre-rRNA processing, and its activity is regulated by both phosphorylation and acetylation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. Pseudogenes of this gene are located on the short arm of chromosomes 3, 11 and X and the long arm of chromosome 11. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality before implantation with embryonic growth arrest. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik C A 6: 40,929,519 probably benign Het
4930402H24Rik A G 2: 130,814,273 V105A probably damaging Het
Abca17 A C 17: 24,335,620 I120S probably benign Het
Abcb5 A C 12: 118,965,329 probably benign Het
Abcc4 T A 14: 118,594,894 T775S probably benign Het
Acnat2 T A 4: 49,380,568 Y270F probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Ankib1 A G 5: 3,706,301 I548T probably damaging Het
Apbb1ip A T 2: 22,874,880 probably null Het
Asb17 C T 3: 153,844,367 S12F probably damaging Het
Atad2b G A 12: 4,965,899 V542I possibly damaging Het
Atxn7 T C 14: 14,096,239 F515L probably damaging Het
Bicc1 A G 10: 70,943,518 L680P probably damaging Het
Bpifb6 G A 2: 153,908,642 R351H probably damaging Het
C4b A G 17: 34,743,650 F26S probably benign Het
Cadps A G 14: 12,517,802 probably null Het
Capza1 G T 3: 104,864,353 S9* probably null Het
Ccdc129 G T 6: 55,968,514 C740F probably benign Het
Ccl11 C T 11: 82,058,040 P25L probably damaging Het
Cdyl A T 13: 35,856,889 K306N probably damaging Het
Cnga3 T C 1: 37,261,498 V471A possibly damaging Het
Col4a4 T C 1: 82,486,659 K983E unknown Het
Cp A C 3: 19,972,717 K436N probably damaging Het
Csmd1 T A 8: 15,918,252 D3125V possibly damaging Het
Daw1 A T 1: 83,183,366 N143I probably damaging Het
Dmd T A X: 84,974,762 I3067N probably benign Het
Dnah11 T G 12: 117,933,845 N3550T possibly damaging Het
Dnm2 T C 9: 21,467,532 V129A possibly damaging Het
Dync1h1 A T 12: 110,665,662 probably null Het
Efemp1 G A 11: 28,916,942 E325K probably benign Het
Enox1 A G 14: 77,577,656 T85A probably benign Het
Faim2 C A 15: 99,520,336 V123F possibly damaging Het
Fgfr2 T C 7: 130,228,620 probably null Het
Fign T C 2: 63,980,374 E184G probably damaging Het
Fnd3c2 T C X: 106,237,699 T799A probably benign Het
Frem2 T C 3: 53,519,938 D2931G probably damaging Het
Fsip2 A G 2: 82,986,345 T4141A probably benign Het
Gigyf2 T A 1: 87,416,983 M546K probably benign Het
Gm21775 G A Y: 10,553,867 V139M probably damaging Het
Gpr83 G T 9: 14,866,849 V172F probably damaging Het
Jmjd4 A G 11: 59,453,612 Y179C probably damaging Het
Kcnq3 A G 15: 66,031,432 L143P probably damaging Het
Klhl41 T C 2: 69,670,939 V248A probably benign Het
Lama1 T C 17: 67,810,155 Y2482H possibly damaging Het
Lamb2 A T 9: 108,483,686 probably null Het
Lclat1 G A 17: 73,196,720 G162R probably damaging Het
Map6 T C 7: 99,268,098 V26A probably damaging Het
Mdn1 A T 4: 32,663,050 D107V probably damaging Het
Metap1d T A 2: 71,524,777 V304D possibly damaging Het
Naca A G 10: 128,043,526 probably benign Het
Napg T C 18: 62,984,072 probably null Het
Nbeal1 T A 1: 60,260,334 F7L probably benign Het
Ndst2 T C 14: 20,724,514 T825A probably benign Het
Nsun2 T C 13: 69,627,103 I353T probably damaging Het
Nt5c3b T A 11: 100,436,210 I87F probably damaging Het
Nxf3 T C X: 136,075,521 D407G probably damaging Het
Olfr568 T A 7: 102,877,663 V181E probably damaging Het
Olfr891 A T 9: 38,180,637 F62Y possibly damaging Het
Osbpl3 A C 6: 50,336,213 probably null Het
P2rx3 T C 2: 85,022,467 T172A possibly damaging Het
Pcdh10 G T 3: 45,381,881 E877* probably null Het
Pcdhb9 A T 18: 37,401,629 K225N probably damaging Het
Plch1 A G 3: 63,740,694 S419P probably damaging Het
Prex2 T G 1: 11,285,089 I1538S possibly damaging Het
Rasl10a A G 11: 5,059,815 E121G possibly damaging Het
Rbbp8 A G 18: 11,732,315 T754A probably benign Het
Rictor T C 15: 6,756,471 V156A probably benign Het
Ryr1 A T 7: 29,116,154 Y104N probably damaging Het
Sctr G T 1: 120,036,439 probably null Het
Sptbn2 T C 19: 4,750,497 Y2247H probably damaging Het
Sqle C T 15: 59,324,509 R384W probably damaging Het
Srcin1 C A 11: 97,518,644 R1163L probably damaging Het
Srp72 A G 5: 76,980,307 Y125C probably damaging Het
Srrm2 T C 17: 23,818,986 S1535P probably benign Het
Sumf2 A G 5: 129,854,716 E125G possibly damaging Het
Tas2r144 A T 6: 42,215,556 I77F probably benign Het
Tcerg1 T C 18: 42,524,349 S299P unknown Het
Tcp1 T A 17: 12,920,423 N212K probably benign Het
Ttc7 G T 17: 87,361,901 G659C probably damaging Het
Ttn A T 2: 76,861,559 probably null Het
Usp30 A G 5: 114,121,146 D428G probably damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Vmn2r58 G A 7: 41,864,056 H388Y probably benign Het
Wdr60 A G 12: 116,225,970 S640P probably damaging Het
Zbtb49 T C 5: 38,213,694 D281G probably damaging Het
Zfp248 A G 6: 118,429,804 S174P probably benign Het
Zswim9 T C 7: 13,277,411 T4A probably benign Het
Other mutations in Ubtf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Ubtf APN 11 102308884 splice site probably benign
IGL02168:Ubtf APN 11 102314168 missense probably damaging 0.99
IGL02218:Ubtf APN 11 102306700 nonsense probably null
FR4304:Ubtf UTSW 11 102306956 small insertion probably benign
FR4304:Ubtf UTSW 11 102306958 small insertion probably benign
FR4340:Ubtf UTSW 11 102306950 small insertion probably benign
FR4342:Ubtf UTSW 11 102306956 small insertion probably benign
FR4342:Ubtf UTSW 11 102306959 small insertion probably benign
FR4449:Ubtf UTSW 11 102306948 nonsense probably null
FR4548:Ubtf UTSW 11 102306958 small insertion probably benign
FR4589:Ubtf UTSW 11 102306943 small insertion probably benign
FR4589:Ubtf UTSW 11 102306945 small insertion probably benign
FR4737:Ubtf UTSW 11 102306948 nonsense probably null
FR4737:Ubtf UTSW 11 102306950 small insertion probably benign
FR4976:Ubtf UTSW 11 102306959 small insertion probably benign
PIT4504001:Ubtf UTSW 11 102306682 missense unknown
R0919:Ubtf UTSW 11 102309777 splice site probably benign
R1023:Ubtf UTSW 11 102311450 missense possibly damaging 0.93
R1641:Ubtf UTSW 11 102310931 missense probably damaging 1.00
R1780:Ubtf UTSW 11 102314918 missense probably damaging 1.00
R2406:Ubtf UTSW 11 102308702 nonsense probably null
R4574:Ubtf UTSW 11 102306765 unclassified probably benign
R4986:Ubtf UTSW 11 102314174 missense probably benign 0.03
R5057:Ubtf UTSW 11 102307087 missense probably damaging 0.96
R5217:Ubtf UTSW 11 102308302 missense probably null 0.91
R5221:Ubtf UTSW 11 102307990 nonsense probably null
R5532:Ubtf UTSW 11 102308959 missense probably benign 0.00
R5634:Ubtf UTSW 11 102310324 missense probably damaging 1.00
R6185:Ubtf UTSW 11 102314023 missense probably damaging 1.00
R7028:Ubtf UTSW 11 102314980 missense probably benign 0.03
R7450:Ubtf UTSW 11 102306649 missense unknown
R7596:Ubtf UTSW 11 102306707 missense unknown
R7601:Ubtf UTSW 11 102306654 missense unknown
RF027:Ubtf UTSW 11 102306945 small insertion probably benign
RF036:Ubtf UTSW 11 102306945 small insertion probably benign
RF041:Ubtf UTSW 11 102306945 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- CCCGGTCATTCTAAGGTACAAACCC -3'
(R):5'- CATGTGGAACGACTTGTCCGAGAAG -3'

Sequencing Primer
(F):5'- GGTACAAACCCAGGATATCAGTTATG -3'
(R):5'- TTGGAGAGACCCCCTACTACTC -3'
Posted On2014-05-09