Mutagenetix > Incidental Mutation

Incidental Mutation 'R1678:Abcb5'

188297

Institutional Source

Beutler Lab

Gene Symbol

Abcb5

Ensembl Gene

ENSMUSG00000072791

Gene Name

ATP-binding cassette, sub-family B (MDR/TAP), member 5

Synonyms

9230106F14Rik

MMRRC Submission

039714-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.215) question?

Stock #

R1678 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

118867824-118966421 bp(-) (GRCm38)

Type of Mutation

start gained

DNA Base Change (assembly)

A to C at 118965329 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000046177 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035515]

AlphaFold

B5X0E4

Predicted Effect

probably benign
Transcript: ENSMUST00000035515

SMART Domains

Protein: ENSMUSP00000046177
Gene: ENSMUSG00000072791

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	49	338	1.9e-74	PFAM
AAA	414	606	2.1e-19	SMART
Pfam:ABC_membrane	693	967	7.3e-59	PFAM
Blast:AAA	969	1040	2e-11	BLAST
AAA	1043	1231	8.26e-18	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ABCB5 belongs to the ATP-binding cassette (ABC) transporter superfamily of integral membrane proteins. These proteins participate in ATP-dependent transmembrane transport of structurally diverse molecules ranging from small ions, sugars, and peptides to more complex organic molecules (Chen et al., 2005 [PubMed 15760339]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700074P13Rik	C	A	6: 40,929,519		probably benign	Het
4930402H24Rik	A	G	2: 130,814,273	V105A	probably damaging	Het
Abca17	A	C	17: 24,335,620	I120S	probably benign	Het
Abcc4	T	A	14: 118,594,894	T775S	probably benign	Het
Acnat2	T	A	4: 49,380,568	Y270F	probably damaging	Het
Aif1	G	A	17: 35,172,151	P44L	probably benign	Het
Ankib1	A	G	5: 3,706,301	I548T	probably damaging	Het
Apbb1ip	A	T	2: 22,874,880		probably null	Het
Asb17	C	T	3: 153,844,367	S12F	probably damaging	Het
Atad2b	G	A	12: 4,965,899	V542I	possibly damaging	Het
Atxn7	T	C	14: 14,096,239	F515L	probably damaging	Het
Bicc1	A	G	10: 70,943,518	L680P	probably damaging	Het
Bpifb6	G	A	2: 153,908,642	R351H	probably damaging	Het
C4b	A	G	17: 34,743,650	F26S	probably benign	Het
Cadps	A	G	14: 12,517,802		probably null	Het
Capza1	G	T	3: 104,864,353	S9*	probably null	Het
Ccdc129	G	T	6: 55,968,514	C740F	probably benign	Het
Ccl11	C	T	11: 82,058,040	P25L	probably damaging	Het
Cdyl	A	T	13: 35,856,889	K306N	probably damaging	Het
Cnga3	T	C	1: 37,261,498	V471A	possibly damaging	Het
Col4a4	T	C	1: 82,486,659	K983E	unknown	Het
Cp	A	C	3: 19,972,717	K436N	probably damaging	Het
Csmd1	T	A	8: 15,918,252	D3125V	possibly damaging	Het
Daw1	A	T	1: 83,183,366	N143I	probably damaging	Het
Dmd	T	A	X: 84,974,762	I3067N	probably benign	Het
Dnah11	T	G	12: 117,933,845	N3550T	possibly damaging	Het
Dnm2	T	C	9: 21,467,532	V129A	possibly damaging	Het
Dync1h1	A	T	12: 110,665,662		probably null	Het
Efemp1	G	A	11: 28,916,942	E325K	probably benign	Het
Enox1	A	G	14: 77,577,656	T85A	probably benign	Het
Faim2	C	A	15: 99,520,336	V123F	possibly damaging	Het
Fgfr2	T	C	7: 130,228,620		probably null	Het
Fign	T	C	2: 63,980,374	E184G	probably damaging	Het
Fnd3c2	T	C	X: 106,237,699	T799A	probably benign	Het
Frem2	T	C	3: 53,519,938	D2931G	probably damaging	Het
Fsip2	A	G	2: 82,986,345	T4141A	probably benign	Het
Gigyf2	T	A	1: 87,416,983	M546K	probably benign	Het
Gm21775	G	A	Y: 10,553,867	V139M	probably damaging	Het
Gpr83	G	T	9: 14,866,849	V172F	probably damaging	Het
Jmjd4	A	G	11: 59,453,612	Y179C	probably damaging	Het
Kcnq3	A	G	15: 66,031,432	L143P	probably damaging	Het
Klhl41	T	C	2: 69,670,939	V248A	probably benign	Het
Lama1	T	C	17: 67,810,155	Y2482H	possibly damaging	Het
Lamb2	A	T	9: 108,483,686		probably null	Het
Lclat1	G	A	17: 73,196,720	G162R	probably damaging	Het
Map6	T	C	7: 99,268,098	V26A	probably damaging	Het
Mdn1	A	T	4: 32,663,050	D107V	probably damaging	Het
Metap1d	T	A	2: 71,524,777	V304D	possibly damaging	Het
Naca	A	G	10: 128,043,526		probably benign	Het
Napg	T	C	18: 62,984,072		probably null	Het
Nbeal1	T	A	1: 60,260,334	F7L	probably benign	Het
Ndst2	T	C	14: 20,724,514	T825A	probably benign	Het
Nsun2	T	C	13: 69,627,103	I353T	probably damaging	Het
Nt5c3b	T	A	11: 100,436,210	I87F	probably damaging	Het
Nxf3	T	C	X: 136,075,521	D407G	probably damaging	Het
Olfr568	T	A	7: 102,877,663	V181E	probably damaging	Het
Olfr891	A	T	9: 38,180,637	F62Y	possibly damaging	Het
Osbpl3	A	C	6: 50,336,213		probably null	Het
P2rx3	T	C	2: 85,022,467	T172A	possibly damaging	Het
Pcdh10	G	T	3: 45,381,881	E877*	probably null	Het
Pcdhb9	A	T	18: 37,401,629	K225N	probably damaging	Het
Plch1	A	G	3: 63,740,694	S419P	probably damaging	Het
Prex2	T	G	1: 11,285,089	I1538S	possibly damaging	Het
Rasl10a	A	G	11: 5,059,815	E121G	possibly damaging	Het
Rbbp8	A	G	18: 11,732,315	T754A	probably benign	Het
Rictor	T	C	15: 6,756,471	V156A	probably benign	Het
Ryr1	A	T	7: 29,116,154	Y104N	probably damaging	Het
Sctr	G	T	1: 120,036,439		probably null	Het
Sptbn2	T	C	19: 4,750,497	Y2247H	probably damaging	Het
Sqle	C	T	15: 59,324,509	R384W	probably damaging	Het
Srcin1	C	A	11: 97,518,644	R1163L	probably damaging	Het
Srp72	A	G	5: 76,980,307	Y125C	probably damaging	Het
Srrm2	T	C	17: 23,818,986	S1535P	probably benign	Het
Sumf2	A	G	5: 129,854,716	E125G	possibly damaging	Het
Tas2r144	A	T	6: 42,215,556	I77F	probably benign	Het
Tcerg1	T	C	18: 42,524,349	S299P	unknown	Het
Tcp1	T	A	17: 12,920,423	N212K	probably benign	Het
Ttc7	G	T	17: 87,361,901	G659C	probably damaging	Het
Ttn	A	T	2: 76,861,559		probably null	Het
Ubtf	A	T	11: 102,308,978	D440E	probably benign	Het
Usp30	A	G	5: 114,121,146	D428G	probably damaging	Het
Vmn2r115	ATCTTCT	ATCT	17: 23,359,988		probably benign	Het
Vmn2r58	G	A	7: 41,864,056	H388Y	probably benign	Het
Wdr60	A	G	12: 116,225,970	S640P	probably damaging	Het
Zbtb49	T	C	5: 38,213,694	D281G	probably damaging	Het
Zfp248	A	G	6: 118,429,804	S174P	probably benign	Het
Zswim9	T	C	7: 13,277,411	T4A	probably benign	Het

Other mutations in Abcb5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Abcb5	APN	12	118890610	missense	probably benign	0.03
IGL00092:Abcb5	APN	12	118928695	missense	probably benign	0.09
IGL00503:Abcb5	APN	12	118907601	missense	probably benign	0.02
IGL00776:Abcb5	APN	12	118919854	missense	probably damaging	1.00
IGL01116:Abcb5	APN	12	118886176	missense	probably benign
IGL01302:Abcb5	APN	12	118918200	missense	probably damaging	1.00
IGL01403:Abcb5	APN	12	118872867	missense	probably damaging	1.00
IGL01453:Abcb5	APN	12	118867970	missense	probably damaging	1.00
IGL01541:Abcb5	APN	12	118911434	missense	probably benign	0.03
IGL01784:Abcb5	APN	12	118890664	missense	probably benign	0.14
IGL01967:Abcb5	APN	12	118867972	missense	probably damaging	1.00
IGL01987:Abcb5	APN	12	118927358	missense	probably damaging	1.00
IGL02104:Abcb5	APN	12	118940680	missense	probably damaging	1.00
IGL02161:Abcb5	APN	12	118874755	missense	probably benign
IGL02292:Abcb5	APN	12	118918197	missense	probably damaging	1.00
IGL02381:Abcb5	APN	12	118940678	missense	probably damaging	1.00
IGL02544:Abcb5	APN	12	118906268	splice site	probably benign
IGL02685:Abcb5	APN	12	118905947	missense	probably damaging	0.99
IGL02824:Abcb5	APN	12	118890685	missense	probably benign	0.05
IGL02876:Abcb5	APN	12	118919841	missense	probably damaging	1.00
IGL02929:Abcb5	APN	12	118944939	missense	probably damaging	0.99
IGL03030:Abcb5	APN	12	118940369	missense	possibly damaging	0.93
IGL03062:Abcb5	APN	12	118936087	missense	probably benign	0.43
IGL03200:Abcb5	APN	12	118965254	splice site	probably benign
IGL03407:Abcb5	APN	12	118940376	missense	probably benign	0.01
alphabet	UTSW	12	118890618	missense	possibly damaging	0.67
google	UTSW	12	118867930	missense	possibly damaging	0.93
F5770:Abcb5	UTSW	12	118886179	missense	probably benign	0.07
PIT4366001:Abcb5	UTSW	12	118936098	missense	probably damaging	1.00
PIT4434001:Abcb5	UTSW	12	118890687	missense	probably damaging	1.00
R0078:Abcb5	UTSW	12	118927394	missense	probably benign
R0219:Abcb5	UTSW	12	118886150	splice site	probably benign
R0312:Abcb5	UTSW	12	118872837	missense	probably damaging	1.00
R0347:Abcb5	UTSW	12	118965251	splice site	probably benign
R0359:Abcb5	UTSW	12	118940332	missense	probably damaging	1.00
R0433:Abcb5	UTSW	12	118877810	missense	probably benign	0.03
R0582:Abcb5	UTSW	12	118940412	missense	probably benign	0.40
R0815:Abcb5	UTSW	12	118901449	splice site	probably benign
R0900:Abcb5	UTSW	12	118940624	missense	probably damaging	1.00
R0942:Abcb5	UTSW	12	118906198	missense	possibly damaging	0.94
R0988:Abcb5	UTSW	12	118932575	missense	probably benign	0.36
R1125:Abcb5	UTSW	12	118911547	missense	possibly damaging	0.87
R1437:Abcb5	UTSW	12	118874762	missense	probably damaging	0.99
R1469:Abcb5	UTSW	12	118867946	missense	possibly damaging	0.83
R1469:Abcb5	UTSW	12	118867946	missense	possibly damaging	0.83
R1726:Abcb5	UTSW	12	118874801	splice site	probably null
R1726:Abcb5	UTSW	12	118907532	missense	possibly damaging	0.95
R1836:Abcb5	UTSW	12	118867961	missense	possibly damaging	0.93
R1934:Abcb5	UTSW	12	118907500	splice site	probably null
R1976:Abcb5	UTSW	12	118890682	missense	probably benign
R2005:Abcb5	UTSW	12	118877827	missense	probably benign	0.15
R2068:Abcb5	UTSW	12	118940568	nonsense	probably null
R2181:Abcb5	UTSW	12	118867946	missense	possibly damaging	0.83
R2191:Abcb5	UTSW	12	118867956	missense	probably damaging	1.00
R3690:Abcb5	UTSW	12	118872933	missense	probably damaging	1.00
R3746:Abcb5	UTSW	12	118874620	missense	probably damaging	0.99
R3825:Abcb5	UTSW	12	118901352	splice site	probably null
R3919:Abcb5	UTSW	12	118890618	missense	possibly damaging	0.67
R4049:Abcb5	UTSW	12	118868669	missense	probably damaging	0.99
R4409:Abcb5	UTSW	12	118872922	missense	probably damaging	0.98
R4606:Abcb5	UTSW	12	118932610	critical splice acceptor site	probably null
R4705:Abcb5	UTSW	12	118965305	missense	possibly damaging	0.95
R4954:Abcb5	UTSW	12	118911434	missense	probably benign	0.03
R4966:Abcb5	UTSW	12	118886891	intron	probably benign
R5169:Abcb5	UTSW	12	118877817	nonsense	probably null
R5327:Abcb5	UTSW	12	118911543	missense	probably benign	0.01
R5333:Abcb5	UTSW	12	118867942	missense	probably damaging	1.00
R5366:Abcb5	UTSW	12	118867930	missense	possibly damaging	0.93
R5373:Abcb5	UTSW	12	118887177	missense	probably damaging	1.00
R5399:Abcb5	UTSW	12	118911499	missense	probably benign
R5416:Abcb5	UTSW	12	118907596	missense	probably damaging	1.00
R5447:Abcb5	UTSW	12	118927326	missense	probably damaging	1.00
R5474:Abcb5	UTSW	12	118940690	missense	probably null	1.00
R5566:Abcb5	UTSW	12	118935967	missense	probably damaging	0.99
R5685:Abcb5	UTSW	12	118932613	splice site	probably null
R5691:Abcb5	UTSW	12	118927235	missense	probably damaging	0.99
R5742:Abcb5	UTSW	12	118918257	missense	probably damaging	0.96
R5852:Abcb5	UTSW	12	118927404	missense	probably damaging	0.99
R5917:Abcb5	UTSW	12	118868781	nonsense	probably null
R5994:Abcb5	UTSW	12	118965260	critical splice donor site	probably null
R6295:Abcb5	UTSW	12	118874644	missense	probably damaging	0.99
R6455:Abcb5	UTSW	12	118890549	critical splice donor site	probably null
R6609:Abcb5	UTSW	12	118928762	missense	probably damaging	1.00
R6753:Abcb5	UTSW	12	118944906	missense	possibly damaging	0.86
R6818:Abcb5	UTSW	12	118901354	splice site	probably null
R6870:Abcb5	UTSW	12	118965265	missense	possibly damaging	0.87
R6944:Abcb5	UTSW	12	118911530	missense	probably benign	0.06
R6957:Abcb5	UTSW	12	118907535	missense	probably damaging	1.00
R6984:Abcb5	UTSW	12	118927277	missense	possibly damaging	0.47
R7021:Abcb5	UTSW	12	118931925	missense	probably benign	0.00
R7061:Abcb5	UTSW	12	118877774	missense	probably damaging	1.00
R7175:Abcb5	UTSW	12	118867876	missense	probably benign	0.00
R7239:Abcb5	UTSW	12	118928725	missense	probably benign	0.19
R7267:Abcb5	UTSW	12	118952470	missense	probably damaging	1.00
R7303:Abcb5	UTSW	12	118911560	missense	probably damaging	0.96
R7396:Abcb5	UTSW	12	118867874	missense	probably damaging	1.00
R7605:Abcb5	UTSW	12	118918164	missense	probably damaging	1.00
R7989:Abcb5	UTSW	12	118911543	missense	probably benign	0.01
R8177:Abcb5	UTSW	12	118872790	missense	possibly damaging	0.65
R8296:Abcb5	UTSW	12	118874732	missense	probably benign	0.01
R8544:Abcb5	UTSW	12	118868726	missense	probably damaging	1.00
R8558:Abcb5	UTSW	12	118877831	missense	probably benign	0.07
R8790:Abcb5	UTSW	12	118867885	missense	possibly damaging	0.91
R9003:Abcb5	UTSW	12	118886278	missense	possibly damaging	0.93
R9038:Abcb5	UTSW	12	118931916	missense	probably benign
R9410:Abcb5	UTSW	12	118905968	missense	probably benign	0.00
R9497:Abcb5	UTSW	12	118936115	missense	probably damaging	0.96
R9666:Abcb5	UTSW	12	118874687	missense	probably damaging	0.98
R9682:Abcb5	UTSW	12	118932593	missense	probably damaging	0.99
R9756:Abcb5	UTSW	12	118918138	missense	probably damaging	0.98
V7580:Abcb5	UTSW	12	118886179	missense	probably benign	0.07
Z1176:Abcb5	UTSW	12	118918272	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACCAAGTGGGCTAGGGAATTGTTC -3'
(R):5'- CTTCACATGCAAGAGAAGGCAGGC -3'

Sequencing Primer
(F):5'- ACCTGTCCTGGAACCAATGTG -3'
(R):5'- AGAAGGCAGGCAGGGTG -3'

Posted On

2014-05-09