Incidental Mutation 'R1679:Wdfy1'
ID188329
Institutional Source Beutler Lab
Gene Symbol Wdfy1
Ensembl Gene ENSMUSG00000073643
Gene NameWD repeat and FYVE domain containing 1
Synonyms1700120F24Rik, 1700013B03Rik, Jr1
MMRRC Submission 039715-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R1679 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location79702262-79776143 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 79707475 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 347 (C347*)
Ref Sequence ENSEMBL: ENSMUSP00000109143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113512] [ENSMUST00000113513] [ENSMUST00000113514] [ENSMUST00000113515] [ENSMUST00000187005]
Predicted Effect probably null
Transcript: ENSMUST00000113512
AA Change: C347*
SMART Domains Protein: ENSMUSP00000109140
Gene: ENSMUSG00000073643
AA Change: C347*

DomainStartEndE-ValueType
WD40 13 52 4.95e-4 SMART
WD40 56 96 5.5e1 SMART
WD40 103 142 1.19e0 SMART
WD40 145 183 2.84e2 SMART
WD40 188 227 1.13e-7 SMART
WD40 231 270 1.22e-3 SMART
FYVE 276 353 3.95e-23 SMART
WD40 355 394 1.7e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113513
AA Change: C347*
SMART Domains Protein: ENSMUSP00000109141
Gene: ENSMUSG00000073643
AA Change: C347*

DomainStartEndE-ValueType
WD40 13 52 4.95e-4 SMART
WD40 56 96 5.5e1 SMART
WD40 103 142 1.19e0 SMART
WD40 145 183 2.84e2 SMART
WD40 188 227 1.13e-7 SMART
WD40 231 270 1.22e-3 SMART
FYVE 276 353 3.95e-23 SMART
WD40 355 394 1.7e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113514
AA Change: C347*
SMART Domains Protein: ENSMUSP00000109142
Gene: ENSMUSG00000073643
AA Change: C347*

DomainStartEndE-ValueType
WD40 13 52 4.95e-4 SMART
WD40 56 96 5.5e1 SMART
WD40 103 142 1.19e0 SMART
WD40 145 183 2.84e2 SMART
WD40 188 227 1.13e-7 SMART
WD40 231 270 1.22e-3 SMART
FYVE 276 353 3.95e-23 SMART
WD40 355 394 1.7e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113515
AA Change: C347*
SMART Domains Protein: ENSMUSP00000109143
Gene: ENSMUSG00000073643
AA Change: C347*

DomainStartEndE-ValueType
WD40 13 52 4.95e-4 SMART
WD40 56 96 5.5e1 SMART
WD40 103 142 1.19e0 SMART
WD40 145 183 2.84e2 SMART
WD40 188 227 1.13e-7 SMART
WD40 231 270 1.22e-3 SMART
FYVE 276 353 3.95e-23 SMART
WD40 355 394 1.7e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187005
SMART Domains Protein: ENSMUSP00000139961
Gene: ENSMUSG00000073643

DomainStartEndE-ValueType
WD40 13 52 3.2e-6 SMART
Blast:WD40 56 93 1e-21 BLAST
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a phosphatidylinositol 3-phosphate binding protein, which contains a FYVE zinc finger domain and multiple WD-40 repeat domains. When exogenously expressed, it localizes to early endosomes. Mutagenesis analysis demonstrates that this endosomal localization is mediated by the FYVE domain. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik GCC GC 13: 59,691,598 probably null Het
Adam6a A G 12: 113,544,756 M250V probably benign Het
Adgre5 C A 8: 83,729,405 R254L probably benign Het
Adgrv1 A T 13: 81,559,552 L525Q probably damaging Het
Ano9 T A 7: 141,108,297 I205F probably benign Het
Bmp5 T C 9: 75,839,595 V245A probably benign Het
Capn8 T C 1: 182,613,467 S489P probably damaging Het
Ccdc85a A G 11: 28,583,316 L76P probably damaging Het
Cd164l2 A G 4: 133,221,499 T49A probably benign Het
Cdc25c T C 18: 34,747,295 T129A probably damaging Het
Cfap43 T C 19: 47,773,114 D847G probably benign Het
Crim1 G A 17: 78,200,799 A11T probably benign Het
Cul9 A T 17: 46,521,156 L1449H possibly damaging Het
Cyp2a22 T A 7: 26,936,311 K276* probably null Het
Cyp2c50 C A 19: 40,111,415 T430K possibly damaging Het
Ddb2 C T 2: 91,234,250 R105Q probably benign Het
Emilin1 T C 5: 30,920,199 Y900H probably benign Het
Eml3 T C 19: 8,936,637 F100L probably damaging Het
Eps8l2 G A 7: 141,361,057 G542D probably damaging Het
Fbf1 A G 11: 116,151,017 probably null Het
Gm21886 T C 18: 80,089,739 Y68C probably damaging Het
H2-Q10 A G 17: 35,473,595 probably benign Het
Hebp2 G T 10: 18,544,415 T90K possibly damaging Het
Il1rl2 A G 1: 40,343,160 T211A probably benign Het
Incenp T C 19: 9,895,414 D16G unknown Het
Isg20l2 T A 3: 87,932,085 M201K probably damaging Het
Kansl1 A T 11: 104,423,996 S405R probably damaging Het
Kdsr T A 1: 106,753,226 I81F probably benign Het
Leprotl1 T G 8: 34,140,832 L7F probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Mtmr2 T A 9: 13,789,077 I60K probably damaging Het
Mto1 A G 9: 78,464,963 T572A probably benign Het
Nipbl G A 15: 8,302,912 T2287I probably benign Het
Nutm2 A G 13: 50,469,386 T40A probably benign Het
Nxf1 T C 19: 8,769,074 S550P probably benign Het
Olfr481 A T 7: 108,081,652 N286I probably damaging Het
Phactr1 G A 13: 43,057,280 V193I possibly damaging Het
Phactr1 A T 13: 43,094,781 Y317F possibly damaging Het
Pih1d1 T C 7: 45,159,826 probably null Het
Rictor T C 15: 6,768,090 I309T possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ruvbl2 T C 7: 45,424,967 D216G probably damaging Het
Slc20a2 T G 8: 22,538,830 S106A possibly damaging Het
Srprb A G 9: 103,192,207 probably benign Het
Stx11 A T 10: 12,941,836 I48N probably damaging Het
Vmn1r29 A T 6: 58,308,018 Y241F probably damaging Het
Zfp683 T C 4: 134,058,645 V361A possibly damaging Het
Other mutations in Wdfy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01131:Wdfy1 APN 1 79713872 missense probably benign 0.00
IGL01473:Wdfy1 APN 1 79707465 missense probably benign 0.00
IGL01934:Wdfy1 APN 1 79740116 missense probably damaging 1.00
IGL02052:Wdfy1 APN 1 79714944 missense probably damaging 0.99
IGL02969:Wdfy1 APN 1 79713871 missense probably benign 0.09
IGL03077:Wdfy1 APN 1 79714905 missense possibly damaging 0.66
IGL03157:Wdfy1 APN 1 79706318 missense probably damaging 1.00
R1592:Wdfy1 UTSW 1 79706255 missense probably damaging 1.00
R1770:Wdfy1 UTSW 1 79709140 missense probably damaging 1.00
R2495:Wdfy1 UTSW 1 79707505 missense probably null 1.00
R3821:Wdfy1 UTSW 1 79706300 missense probably benign 0.00
R4431:Wdfy1 UTSW 1 79713866 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGACTACTCCAACGACCCTCATTG -3'
(R):5'- AAGCACATTCTCCCCGAGTTTACAG -3'

Sequencing Primer
(F):5'- aggcaaggcacttatccac -3'
(R):5'- TCCCCGAGTTTACAGGAATG -3'
Posted On2014-05-09