Incidental Mutation 'R1679:Kdsr'
ID188330
Institutional Source Beutler Lab
Gene Symbol Kdsr
Ensembl Gene ENSMUSG00000009905
Gene Name3-ketodihydrosphingosine reductase
SynonymsFvt1, 6330410P18Rik, 9430079B08Rik
MMRRC Submission 039715-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.930) question?
Stock #R1679 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location106720459-106759727 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 106753226 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 81 (I81F)
Ref Sequence ENSEMBL: ENSMUSP00000010049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010049]
Predicted Effect probably benign
Transcript: ENSMUST00000010049
AA Change: I81F

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000010049
Gene: ENSMUSG00000009905
AA Change: I81F

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
Pfam:KR 33 214 9.4e-16 PFAM
Pfam:adh_short 33 232 1.1e-59 PFAM
Pfam:adh_short_C2 39 217 5.7e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187319
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187617
Meta Mutation Damage Score 0.2113 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the reduction of 3-ketodihydrosphingosine to dihydrosphingosine. The putative active site residues of the encoded protein are found on the cytosolic side of the endoplasmic reticulum membrane. A chromosomal rearrangement involving this gene is a cause of follicular lymphoma, also known as type II chronic lymphatic leukemia. The mutation of a conserved residue in the bovine ortholog causes spinal muscular atrophy. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik GCC GC 13: 59,691,598 probably null Het
Adam6a A G 12: 113,544,756 M250V probably benign Het
Adgre5 C A 8: 83,729,405 R254L probably benign Het
Adgrv1 A T 13: 81,559,552 L525Q probably damaging Het
Ano9 T A 7: 141,108,297 I205F probably benign Het
Bmp5 T C 9: 75,839,595 V245A probably benign Het
Capn8 T C 1: 182,613,467 S489P probably damaging Het
Ccdc85a A G 11: 28,583,316 L76P probably damaging Het
Cd164l2 A G 4: 133,221,499 T49A probably benign Het
Cdc25c T C 18: 34,747,295 T129A probably damaging Het
Cfap43 T C 19: 47,773,114 D847G probably benign Het
Crim1 G A 17: 78,200,799 A11T probably benign Het
Cul9 A T 17: 46,521,156 L1449H possibly damaging Het
Cyp2a22 T A 7: 26,936,311 K276* probably null Het
Cyp2c50 C A 19: 40,111,415 T430K possibly damaging Het
Ddb2 C T 2: 91,234,250 R105Q probably benign Het
Emilin1 T C 5: 30,920,199 Y900H probably benign Het
Eml3 T C 19: 8,936,637 F100L probably damaging Het
Eps8l2 G A 7: 141,361,057 G542D probably damaging Het
Fbf1 A G 11: 116,151,017 probably null Het
Gm21886 T C 18: 80,089,739 Y68C probably damaging Het
H2-Q10 A G 17: 35,473,595 probably benign Het
Hebp2 G T 10: 18,544,415 T90K possibly damaging Het
Il1rl2 A G 1: 40,343,160 T211A probably benign Het
Incenp T C 19: 9,895,414 D16G unknown Het
Isg20l2 T A 3: 87,932,085 M201K probably damaging Het
Kansl1 A T 11: 104,423,996 S405R probably damaging Het
Leprotl1 T G 8: 34,140,832 L7F probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Mtmr2 T A 9: 13,789,077 I60K probably damaging Het
Mto1 A G 9: 78,464,963 T572A probably benign Het
Nipbl G A 15: 8,302,912 T2287I probably benign Het
Nutm2 A G 13: 50,469,386 T40A probably benign Het
Nxf1 T C 19: 8,769,074 S550P probably benign Het
Olfr481 A T 7: 108,081,652 N286I probably damaging Het
Phactr1 G A 13: 43,057,280 V193I possibly damaging Het
Phactr1 A T 13: 43,094,781 Y317F possibly damaging Het
Pih1d1 T C 7: 45,159,826 probably null Het
Rictor T C 15: 6,768,090 I309T possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ruvbl2 T C 7: 45,424,967 D216G probably damaging Het
Slc20a2 T G 8: 22,538,830 S106A possibly damaging Het
Srprb A G 9: 103,192,207 probably benign Het
Stx11 A T 10: 12,941,836 I48N probably damaging Het
Vmn1r29 A T 6: 58,308,018 Y241F probably damaging Het
Wdfy1 A T 1: 79,707,475 C347* probably null Het
Zfp683 T C 4: 134,058,645 V361A possibly damaging Het
Other mutations in Kdsr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Kdsr APN 1 106755457 missense possibly damaging 0.91
IGL01375:Kdsr APN 1 106727694 missense probably benign 0.06
R0361:Kdsr UTSW 1 106747787 missense probably damaging 0.97
R1051:Kdsr UTSW 1 106747580 nonsense probably null
R1589:Kdsr UTSW 1 106734541 splice site probably null
R4890:Kdsr UTSW 1 106753234 missense probably benign 0.21
R5392:Kdsr UTSW 1 106753241 missense possibly damaging 0.88
R5500:Kdsr UTSW 1 106759644 unclassified probably benign
R5830:Kdsr UTSW 1 106747532 missense possibly damaging 0.89
R5850:Kdsr UTSW 1 106755442 critical splice donor site probably null
R6005:Kdsr UTSW 1 106734581 missense probably benign 0.01
R7515:Kdsr UTSW 1 106734560 missense possibly damaging 0.89
R7841:Kdsr UTSW 1 106743685 missense probably damaging 1.00
R8282:Kdsr UTSW 1 106724997 missense probably benign 0.03
R8312:Kdsr UTSW 1 106747486 critical splice donor site probably null
R8392:Kdsr UTSW 1 106743853 missense probably damaging 1.00
R8507:Kdsr UTSW 1 106743670 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- AGTCAACCAGTCACTGACTTGCAC -3'
(R):5'- GCAACACTAATGCTGCTGAGAGGG -3'

Sequencing Primer
(F):5'- ACAGTGTCTGTATCAGTTTAGTACCC -3'
(R):5'- GGACTTAAATGAACCCTGCTGTG -3'
Posted On2014-05-09