Incidental Mutation 'R1679:Ruvbl2'
ID188347
Institutional Source Beutler Lab
Gene Symbol Ruvbl2
Ensembl Gene ENSMUSG00000003868
Gene NameRuvB-like protein 2
Synonymsp47, mp47
MMRRC Submission 039715-MU
Accession Numbers

Genbank: NM_011304

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1679 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location45421760-45438096 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45424967 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 216 (D216G)
Ref Sequence ENSEMBL: ENSMUSP00000148040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072453] [ENSMUST00000107771] [ENSMUST00000210271] [ENSMUST00000210439] [ENSMUST00000211214] [ENSMUST00000211666]
Predicted Effect probably benign
Transcript: ENSMUST00000072453
SMART Domains Protein: ENSMUSP00000072276
Gene: ENSMUSG00000100916

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
GHB 25 131 2.2e-64 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107771
AA Change: D216G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103400
Gene: ENSMUSG00000003868
AA Change: D216G

DomainStartEndE-ValueType
AAA 69 361 5.17e-10 SMART
Blast:AAA 373 417 3e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000209426
Predicted Effect probably benign
Transcript: ENSMUST00000210271
Predicted Effect probably damaging
Transcript: ENSMUST00000210439
AA Change: D196G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000211214
AA Change: D216G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000211440
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211478
Predicted Effect probably damaging
Transcript: ENSMUST00000211666
AA Change: D216G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.8590 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the second human homologue of the bacterial RuvB gene. Bacterial RuvB protein is a DNA helicase essential for homologous recombination and DNA double-strand break repair. Functional analysis showed that this gene product has both ATPase and DNA helicase activities. This gene is physically linked to the CGB/LHB gene cluster on chromosome 19q13.3, and is very close (55 nt) to the LHB gene, in the opposite orientation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit lethality. Mice heterozygous for a knock-out allele exhibit impaired T cell development and maximal T dependent antibody responses. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Targeted, knock-out(1) Gene trapped(11)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik GCC GC 13: 59,691,598 probably null Het
Adam6a A G 12: 113,544,756 M250V probably benign Het
Adgre5 C A 8: 83,729,405 R254L probably benign Het
Adgrv1 A T 13: 81,559,552 L525Q probably damaging Het
Ano9 T A 7: 141,108,297 I205F probably benign Het
Bmp5 T C 9: 75,839,595 V245A probably benign Het
Capn8 T C 1: 182,613,467 S489P probably damaging Het
Ccdc85a A G 11: 28,583,316 L76P probably damaging Het
Cd164l2 A G 4: 133,221,499 T49A probably benign Het
Cdc25c T C 18: 34,747,295 T129A probably damaging Het
Cfap43 T C 19: 47,773,114 D847G probably benign Het
Crim1 G A 17: 78,200,799 A11T probably benign Het
Cul9 A T 17: 46,521,156 L1449H possibly damaging Het
Cyp2a22 T A 7: 26,936,311 K276* probably null Het
Cyp2c50 C A 19: 40,111,415 T430K possibly damaging Het
Ddb2 C T 2: 91,234,250 R105Q probably benign Het
Emilin1 T C 5: 30,920,199 Y900H probably benign Het
Eml3 T C 19: 8,936,637 F100L probably damaging Het
Eps8l2 G A 7: 141,361,057 G542D probably damaging Het
Fbf1 A G 11: 116,151,017 probably null Het
Gm21886 T C 18: 80,089,739 Y68C probably damaging Het
H2-Q10 A G 17: 35,473,595 probably benign Het
Hebp2 G T 10: 18,544,415 T90K possibly damaging Het
Il1rl2 A G 1: 40,343,160 T211A probably benign Het
Incenp T C 19: 9,895,414 D16G unknown Het
Isg20l2 T A 3: 87,932,085 M201K probably damaging Het
Kansl1 A T 11: 104,423,996 S405R probably damaging Het
Kdsr T A 1: 106,753,226 I81F probably benign Het
Leprotl1 T G 8: 34,140,832 L7F probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Mtmr2 T A 9: 13,789,077 I60K probably damaging Het
Mto1 A G 9: 78,464,963 T572A probably benign Het
Nipbl G A 15: 8,302,912 T2287I probably benign Het
Nutm2 A G 13: 50,469,386 T40A probably benign Het
Nxf1 T C 19: 8,769,074 S550P probably benign Het
Olfr481 A T 7: 108,081,652 N286I probably damaging Het
Phactr1 G A 13: 43,057,280 V193I possibly damaging Het
Phactr1 A T 13: 43,094,781 Y317F possibly damaging Het
Pih1d1 T C 7: 45,159,826 probably null Het
Rictor T C 15: 6,768,090 I309T possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Slc20a2 T G 8: 22,538,830 S106A possibly damaging Het
Srprb A G 9: 103,192,207 probably benign Het
Stx11 A T 10: 12,941,836 I48N probably damaging Het
Vmn1r29 A T 6: 58,308,018 Y241F probably damaging Het
Wdfy1 A T 1: 79,707,475 C347* probably null Het
Zfp683 T C 4: 134,058,645 V361A possibly damaging Het
Other mutations in Ruvbl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Ruvbl2 APN 7 45425172 missense probably benign 0.07
IGL00970:Ruvbl2 APN 7 45429570 missense possibly damaging 0.59
IGL01084:Ruvbl2 APN 7 45422523 splice site probably null
IGL01382:Ruvbl2 APN 7 45422737 missense probably benign 0.00
IGL01798:Ruvbl2 APN 7 45422163 missense probably damaging 1.00
IGL01936:Ruvbl2 APN 7 45428698 missense probably damaging 1.00
IGL02282:Ruvbl2 APN 7 45425165 missense probably benign
Worker UTSW 7 45431318 critical splice donor site probably benign
R0510:Ruvbl2 UTSW 7 45431306 splice site probably benign
R0570:Ruvbl2 UTSW 7 45422197 missense probably damaging 1.00
R1533:Ruvbl2 UTSW 7 45424142 missense probably damaging 1.00
R1591:Ruvbl2 UTSW 7 45424711 missense possibly damaging 0.57
R1758:Ruvbl2 UTSW 7 45425162 missense probably benign 0.39
R2113:Ruvbl2 UTSW 7 45424103 unclassified probably null
R3017:Ruvbl2 UTSW 7 45422164 missense probably damaging 0.99
R3806:Ruvbl2 UTSW 7 45422190 missense possibly damaging 0.65
R4940:Ruvbl2 UTSW 7 45424726 missense probably damaging 1.00
R6045:Ruvbl2 UTSW 7 45425009 missense probably damaging 1.00
R6222:Ruvbl2 UTSW 7 45424725 missense probably damaging 1.00
R6754:Ruvbl2 UTSW 7 45428758 missense probably benign 0.07
R6947:Ruvbl2 UTSW 7 45424949 critical splice donor site probably null
R7366:Ruvbl2 UTSW 7 45422149 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- AAGCCCTGAGTACGGGAGTTGATG -3'
(R):5'- ATCGAGTCCCTGACCAAGGACAAG -3'

Sequencing Primer
(F):5'- TGGGCACTGCACAAACTTG -3'
(R):5'- CTGACCAAGGACAAGGTCCAG -3'
Posted On2014-05-09