Incidental Mutation 'R1679:Ano9'
ID188349
Institutional Source Beutler Lab
Gene Symbol Ano9
Ensembl Gene ENSMUSG00000054662
Gene Nameanoctamin 9
Synonyms5430425C04Rik, Tmem16j, Trp53i5, Tp53i5
MMRRC Submission 039715-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R1679 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location141101212-141117806 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 141108297 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 205 (I205F)
Ref Sequence ENSEMBL: ENSMUSP00000067689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067836]
Predicted Effect probably benign
Transcript: ENSMUST00000067836
AA Change: I205F

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000067689
Gene: ENSMUSG00000054662
AA Change: I205F

DomainStartEndE-ValueType
Pfam:Anoctamin 174 730 3.3e-118 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210085
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210496
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211515
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TMEM16 (anoctamin) family of proteins, some of which form integral membrane calcium-activated chloride channels. The function of the encoded protein has yet to be elucidated, although it may have channel-forming abilities and also may have phospholipid scramblase activity. This gene has been observed to be upregulated in stage II and III colorectal cancers. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik GCC GC 13: 59,691,598 probably null Het
Adam6a A G 12: 113,544,756 M250V probably benign Het
Adgre5 C A 8: 83,729,405 R254L probably benign Het
Adgrv1 A T 13: 81,559,552 L525Q probably damaging Het
Bmp5 T C 9: 75,839,595 V245A probably benign Het
Capn8 T C 1: 182,613,467 S489P probably damaging Het
Ccdc85a A G 11: 28,583,316 L76P probably damaging Het
Cd164l2 A G 4: 133,221,499 T49A probably benign Het
Cdc25c T C 18: 34,747,295 T129A probably damaging Het
Cfap43 T C 19: 47,773,114 D847G probably benign Het
Crim1 G A 17: 78,200,799 A11T probably benign Het
Cul9 A T 17: 46,521,156 L1449H possibly damaging Het
Cyp2a22 T A 7: 26,936,311 K276* probably null Het
Cyp2c50 C A 19: 40,111,415 T430K possibly damaging Het
Ddb2 C T 2: 91,234,250 R105Q probably benign Het
Emilin1 T C 5: 30,920,199 Y900H probably benign Het
Eml3 T C 19: 8,936,637 F100L probably damaging Het
Eps8l2 G A 7: 141,361,057 G542D probably damaging Het
Fbf1 A G 11: 116,151,017 probably null Het
Gm21886 T C 18: 80,089,739 Y68C probably damaging Het
H2-Q10 A G 17: 35,473,595 probably benign Het
Hebp2 G T 10: 18,544,415 T90K possibly damaging Het
Il1rl2 A G 1: 40,343,160 T211A probably benign Het
Incenp T C 19: 9,895,414 D16G unknown Het
Isg20l2 T A 3: 87,932,085 M201K probably damaging Het
Kansl1 A T 11: 104,423,996 S405R probably damaging Het
Kdsr T A 1: 106,753,226 I81F probably benign Het
Leprotl1 T G 8: 34,140,832 L7F probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Mtmr2 T A 9: 13,789,077 I60K probably damaging Het
Mto1 A G 9: 78,464,963 T572A probably benign Het
Nipbl G A 15: 8,302,912 T2287I probably benign Het
Nutm2 A G 13: 50,469,386 T40A probably benign Het
Nxf1 T C 19: 8,769,074 S550P probably benign Het
Olfr481 A T 7: 108,081,652 N286I probably damaging Het
Phactr1 G A 13: 43,057,280 V193I possibly damaging Het
Phactr1 A T 13: 43,094,781 Y317F possibly damaging Het
Pih1d1 T C 7: 45,159,826 probably null Het
Rictor T C 15: 6,768,090 I309T possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ruvbl2 T C 7: 45,424,967 D216G probably damaging Het
Slc20a2 T G 8: 22,538,830 S106A possibly damaging Het
Srprb A G 9: 103,192,207 probably benign Het
Stx11 A T 10: 12,941,836 I48N probably damaging Het
Vmn1r29 A T 6: 58,308,018 Y241F probably damaging Het
Wdfy1 A T 1: 79,707,475 C347* probably null Het
Zfp683 T C 4: 134,058,645 V361A possibly damaging Het
Other mutations in Ano9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Ano9 APN 7 141102042 nonsense probably null
IGL01620:Ano9 APN 7 141110439 missense probably damaging 1.00
IGL02045:Ano9 APN 7 141102469 missense probably benign 0.00
IGL02506:Ano9 APN 7 141102254 unclassified probably benign
IGL02657:Ano9 APN 7 141107440 missense probably damaging 1.00
IGL02731:Ano9 APN 7 141107204 missense probably damaging 1.00
IGL02863:Ano9 APN 7 141108651 missense probably benign 0.00
R0114:Ano9 UTSW 7 141103239 unclassified probably benign
R0374:Ano9 UTSW 7 141107814 missense probably damaging 0.98
R0487:Ano9 UTSW 7 141107849 missense possibly damaging 0.85
R0600:Ano9 UTSW 7 141104710 missense probably damaging 1.00
R0702:Ano9 UTSW 7 141107282 missense probably damaging 1.00
R0765:Ano9 UTSW 7 141107184 missense probably damaging 1.00
R1773:Ano9 UTSW 7 141108378 missense possibly damaging 0.95
R1809:Ano9 UTSW 7 141108804 missense possibly damaging 0.93
R1883:Ano9 UTSW 7 141102331 missense probably benign
R2034:Ano9 UTSW 7 141108135 missense probably damaging 0.99
R2159:Ano9 UTSW 7 141108117 missense probably benign 0.01
R2254:Ano9 UTSW 7 141103090 missense probably benign
R2293:Ano9 UTSW 7 141102515 missense probably benign
R3177:Ano9 UTSW 7 141104124 missense probably damaging 1.00
R3277:Ano9 UTSW 7 141104124 missense probably damaging 1.00
R4274:Ano9 UTSW 7 141110695 missense probably benign
R4576:Ano9 UTSW 7 141104138 missense probably damaging 1.00
R4577:Ano9 UTSW 7 141104138 missense probably damaging 1.00
R4872:Ano9 UTSW 7 141107204 missense probably damaging 1.00
R4879:Ano9 UTSW 7 141110502 missense probably benign 0.23
R5160:Ano9 UTSW 7 141104365 missense probably damaging 1.00
R5560:Ano9 UTSW 7 141110482 missense probably damaging 1.00
R6148:Ano9 UTSW 7 141106785 missense probably damaging 1.00
R6302:Ano9 UTSW 7 141104308 missense probably damaging 1.00
R6821:Ano9 UTSW 7 141107256 missense possibly damaging 0.70
R7253:Ano9 UTSW 7 141107437 missense probably damaging 0.96
R7479:Ano9 UTSW 7 141102435 missense probably damaging 0.99
R7836:Ano9 UTSW 7 141103201 missense probably damaging 1.00
R7919:Ano9 UTSW 7 141103201 missense probably damaging 1.00
R8051:Ano9 UTSW 7 141104532 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGCCCAGGAAAGACTCCAGTAG -3'
(R):5'- TGACTGACAGACACAGTAGTCCCC -3'

Sequencing Primer
(F):5'- TGCACATCTCTGAGAGTCGC -3'
(R):5'- GTAGTCCCCACTTACACTGAGG -3'
Posted On2014-05-09