Incidental Mutation 'R1679:Srprb'
ID188357
Institutional Source Beutler Lab
Gene Symbol Srprb
Ensembl Gene ENSMUSG00000032553
Gene Namesignal recognition particle receptor, B subunit
Synonyms
MMRRC Submission 039715-MU
Accession Numbers

Genbank: NM_009275.4; Ensembl: ENSMUST00000035157

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1679 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location103188032-103202137 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 103192207 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035157] [ENSMUST00000166836] [ENSMUST00000190760]
Predicted Effect probably benign
Transcript: ENSMUST00000035157
SMART Domains Protein: ENSMUSP00000035157
Gene: ENSMUSG00000032553

DomainStartEndE-ValueType
Pfam:Arf 49 221 1.1e-17 PFAM
Pfam:SRPRB 60 239 1.2e-75 PFAM
Pfam:FeoB_N 63 214 7e-7 PFAM
Pfam:MMR_HSR1 64 179 3.8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163567
Predicted Effect probably benign
Transcript: ENSMUST00000166836
SMART Domains Protein: ENSMUSP00000127808
Gene: ENSMUSG00000090639

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
TR_FER 25 338 4.98e-175 SMART
TR_FER 346 672 8.64e-193 SMART
Pfam:Arf 758 928 1.5e-15 PFAM
Pfam:SRPRB 769 948 1.4e-73 PFAM
Pfam:MMR_HSR1 773 888 7.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190760
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has similarity to mouse protein which is a subunit of the signal recognition particle receptor (SR). This subunit is a transmembrane GTPase belonging to the GTPase superfamily. It anchors alpha subunit, a peripheral membrane GTPase, to the ER membrane. SR is required for the cotranslational targeting of both secretory and membrane proteins to the ER membrane. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(6) : Gene trapped(6)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik GCC GC 13: 59,691,598 probably null Het
Adam6a A G 12: 113,544,756 M250V probably benign Het
Adgre5 C A 8: 83,729,405 R254L probably benign Het
Adgrv1 A T 13: 81,559,552 L525Q probably damaging Het
Ano9 T A 7: 141,108,297 I205F probably benign Het
Bmp5 T C 9: 75,839,595 V245A probably benign Het
Capn8 T C 1: 182,613,467 S489P probably damaging Het
Ccdc85a A G 11: 28,583,316 L76P probably damaging Het
Cd164l2 A G 4: 133,221,499 T49A probably benign Het
Cdc25c T C 18: 34,747,295 T129A probably damaging Het
Cfap43 T C 19: 47,773,114 D847G probably benign Het
Crim1 G A 17: 78,200,799 A11T probably benign Het
Cul9 A T 17: 46,521,156 L1449H possibly damaging Het
Cyp2a22 T A 7: 26,936,311 K276* probably null Het
Cyp2c50 C A 19: 40,111,415 T430K possibly damaging Het
Ddb2 C T 2: 91,234,250 R105Q probably benign Het
Emilin1 T C 5: 30,920,199 Y900H probably benign Het
Eml3 T C 19: 8,936,637 F100L probably damaging Het
Eps8l2 G A 7: 141,361,057 G542D probably damaging Het
Fbf1 A G 11: 116,151,017 probably null Het
Gm21886 T C 18: 80,089,739 Y68C probably damaging Het
H2-Q10 A G 17: 35,473,595 probably benign Het
Hebp2 G T 10: 18,544,415 T90K possibly damaging Het
Il1rl2 A G 1: 40,343,160 T211A probably benign Het
Incenp T C 19: 9,895,414 D16G unknown Het
Isg20l2 T A 3: 87,932,085 M201K probably damaging Het
Kansl1 A T 11: 104,423,996 S405R probably damaging Het
Kdsr T A 1: 106,753,226 I81F probably benign Het
Leprotl1 T G 8: 34,140,832 L7F probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Mtmr2 T A 9: 13,789,077 I60K probably damaging Het
Mto1 A G 9: 78,464,963 T572A probably benign Het
Nipbl G A 15: 8,302,912 T2287I probably benign Het
Nutm2 A G 13: 50,469,386 T40A probably benign Het
Nxf1 T C 19: 8,769,074 S550P probably benign Het
Olfr481 A T 7: 108,081,652 N286I probably damaging Het
Phactr1 G A 13: 43,057,280 V193I possibly damaging Het
Phactr1 A T 13: 43,094,781 Y317F possibly damaging Het
Pih1d1 T C 7: 45,159,826 probably null Het
Rictor T C 15: 6,768,090 I309T possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ruvbl2 T C 7: 45,424,967 D216G probably damaging Het
Slc20a2 T G 8: 22,538,830 S106A possibly damaging Het
Stx11 A T 10: 12,941,836 I48N probably damaging Het
Vmn1r29 A T 6: 58,308,018 Y241F probably damaging Het
Wdfy1 A T 1: 79,707,475 C347* probably null Het
Zfp683 T C 4: 134,058,645 V361A possibly damaging Het
Other mutations in Srprb
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0308:Srprb UTSW 9 103202005 missense possibly damaging 0.64
R0739:Srprb UTSW 9 103197595 missense probably damaging 1.00
R1434:Srprb UTSW 9 103190302 missense probably damaging 1.00
R2370:Srprb UTSW 9 103197556 missense probably damaging 0.99
R2851:Srprb UTSW 9 103198839 nonsense probably null
R2853:Srprb UTSW 9 103198839 nonsense probably null
R4161:Srprb UTSW 9 103201330 missense possibly damaging 0.88
R4914:Srprb UTSW 9 103201948 missense possibly damaging 0.59
R5260:Srprb UTSW 9 103201920 missense probably damaging 1.00
R5588:Srprb UTSW 9 103198849 nonsense probably null
R5624:Srprb UTSW 9 103197601 missense probably damaging 1.00
R6052:Srprb UTSW 9 103190216 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- CCTTGGGACAACCTGGTAAAAGACC -3'
(R):5'- GGTACATTCTGCCCTGTGTTCATCG -3'

Sequencing Primer
(F):5'- CTGGTAAAAGACCAGGAAAGTAATAG -3'
(R):5'- GAAAGCCCAAGTCATTTCTTGTG -3'
Posted On2014-05-09