Incidental Mutation 'R1679:H2-Q10'
ID188371
Institutional Source Beutler Lab
Gene Symbol H2-Q10
Ensembl Gene ENSMUSG00000067235
Gene Namehistocompatibility 2, Q region locus 10
SynonymsH-2Q10, Qa10, Q10
MMRRC Submission 039715-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1679 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location35470089-35474563 bp(+) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) A to G at 35473595 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068291] [ENSMUST00000174525]
Predicted Effect probably benign
Transcript: ENSMUST00000068291
SMART Domains Protein: ENSMUSP00000066419
Gene: ENSMUSG00000067235

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
Pfam:MHC_I 25 203 5.8e-98 PFAM
IGc1 222 293 8.23e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174525
SMART Domains Protein: ENSMUSP00000134163
Gene: ENSMUSG00000067235

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
Pfam:MHC_I 25 203 3.3e-99 PFAM
IGc1 222 293 8.23e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174589
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 98% (51/52)
MGI Phenotype PHENOTYPE: Unlike other class I genes, this gene is expressed only in liver cells and its product is secreted into the serum. The amount of protein in serum varies among inbred strains with different H2 haplotypes and is completely absent in the H2f strain B10.M. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik GCC GC 13: 59,691,598 probably null Het
Adam6a A G 12: 113,544,756 M250V probably benign Het
Adgre5 C A 8: 83,729,405 R254L probably benign Het
Adgrv1 A T 13: 81,559,552 L525Q probably damaging Het
Ano9 T A 7: 141,108,297 I205F probably benign Het
Bmp5 T C 9: 75,839,595 V245A probably benign Het
Capn8 T C 1: 182,613,467 S489P probably damaging Het
Ccdc85a A G 11: 28,583,316 L76P probably damaging Het
Cd164l2 A G 4: 133,221,499 T49A probably benign Het
Cdc25c T C 18: 34,747,295 T129A probably damaging Het
Cfap43 T C 19: 47,773,114 D847G probably benign Het
Crim1 G A 17: 78,200,799 A11T probably benign Het
Cul9 A T 17: 46,521,156 L1449H possibly damaging Het
Cyp2a22 T A 7: 26,936,311 K276* probably null Het
Cyp2c50 C A 19: 40,111,415 T430K possibly damaging Het
Ddb2 C T 2: 91,234,250 R105Q probably benign Het
Emilin1 T C 5: 30,920,199 Y900H probably benign Het
Eml3 T C 19: 8,936,637 F100L probably damaging Het
Eps8l2 G A 7: 141,361,057 G542D probably damaging Het
Fbf1 A G 11: 116,151,017 probably null Het
Gm21886 T C 18: 80,089,739 Y68C probably damaging Het
Hebp2 G T 10: 18,544,415 T90K possibly damaging Het
Il1rl2 A G 1: 40,343,160 T211A probably benign Het
Incenp T C 19: 9,895,414 D16G unknown Het
Isg20l2 T A 3: 87,932,085 M201K probably damaging Het
Kansl1 A T 11: 104,423,996 S405R probably damaging Het
Kdsr T A 1: 106,753,226 I81F probably benign Het
Leprotl1 T G 8: 34,140,832 L7F probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Mtmr2 T A 9: 13,789,077 I60K probably damaging Het
Mto1 A G 9: 78,464,963 T572A probably benign Het
Nipbl G A 15: 8,302,912 T2287I probably benign Het
Nutm2 A G 13: 50,469,386 T40A probably benign Het
Nxf1 T C 19: 8,769,074 S550P probably benign Het
Olfr481 A T 7: 108,081,652 N286I probably damaging Het
Phactr1 G A 13: 43,057,280 V193I possibly damaging Het
Phactr1 A T 13: 43,094,781 Y317F possibly damaging Het
Pih1d1 T C 7: 45,159,826 probably null Het
Rictor T C 15: 6,768,090 I309T possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ruvbl2 T C 7: 45,424,967 D216G probably damaging Het
Slc20a2 T G 8: 22,538,830 S106A possibly damaging Het
Srprb A G 9: 103,192,207 probably benign Het
Stx11 A T 10: 12,941,836 I48N probably damaging Het
Vmn1r29 A T 6: 58,308,018 Y241F probably damaging Het
Wdfy1 A T 1: 79,707,475 C347* probably null Het
Zfp683 T C 4: 134,058,645 V361A possibly damaging Het
Other mutations in H2-Q10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01893:H2-Q10 APN 17 35473271 missense probably damaging 1.00
IGL02003:H2-Q10 APN 17 35470441 missense probably benign 0.01
IGL02308:H2-Q10 APN 17 35473566 makesense probably null
IGL02804:H2-Q10 APN 17 35473250 missense probably damaging 1.00
gomez UTSW 17 35474020 utr 3 prime probably benign
lurch UTSW 17 35471018 missense possibly damaging 0.92
R0278:H2-Q10 UTSW 17 35473307 missense possibly damaging 0.83
R1919:H2-Q10 UTSW 17 35470488 missense probably damaging 1.00
R3781:H2-Q10 UTSW 17 35471018 missense possibly damaging 0.92
R3782:H2-Q10 UTSW 17 35471018 missense possibly damaging 0.92
R4614:H2-Q10 UTSW 17 35474020 utr 3 prime probably benign
R4814:H2-Q10 UTSW 17 35473584 utr 3 prime probably benign
R4870:H2-Q10 UTSW 17 35470460 missense probably damaging 1.00
R6063:H2-Q10 UTSW 17 35470129 missense probably benign 0.13
R7448:H2-Q10 UTSW 17 35473560 missense not run
R7728:H2-Q10 UTSW 17 35470838 missense probably damaging 0.98
R8034:H2-Q10 UTSW 17 35470441 missense probably damaging 1.00
R8172:H2-Q10 UTSW 17 35471099 missense probably null 1.00
R8233:H2-Q10 UTSW 17 35471086 missense probably benign 0.28
R8400:H2-Q10 UTSW 17 35470477 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTCTTGGGAAGGAGCAGAATTAC -3'
(R):5'- ACATCTCCAGCTTCACTGCAATGTC -3'

Sequencing Primer
(F):5'- ACATGCCATGTGTACCATGAG -3'
(R):5'- TCACTGCAATGTCCCCAGG -3'
Posted On2014-05-09