Incidental Mutation 'R1679:Incenp'
ID 188378
Institutional Source Beutler Lab
Gene Symbol Incenp
Ensembl Gene ENSMUSG00000024660
Gene Name inner centromere protein
Synonyms 2700067E22Rik
MMRRC Submission 039715-MU
Accession Numbers

Genbank: NM_016692

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1679 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 9872297-9899533 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 9895414 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 16 (D16G)
Ref Sequence ENSEMBL: ENSMUSP00000025562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025562]
AlphaFold Q9WU62
Predicted Effect unknown
Transcript: ENSMUST00000025562
AA Change: D16G
SMART Domains Protein: ENSMUSP00000025562
Gene: ENSMUSG00000024660
AA Change: D16G

DomainStartEndE-ValueType
Pfam:INCENP_N 6 41 1.9e-18 PFAM
low complexity region 83 94 N/A INTRINSIC
low complexity region 123 145 N/A INTRINSIC
low complexity region 308 314 N/A INTRINSIC
low complexity region 350 367 N/A INTRINSIC
low complexity region 434 447 N/A INTRINSIC
low complexity region 517 553 N/A INTRINSIC
low complexity region 557 573 N/A INTRINSIC
SCOP:d1f5na1 631 739 7e-3 SMART
Pfam:INCENP_ARK-bind 789 846 1.5e-22 PFAM
Meta Mutation Damage Score 0.0656 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In mammalian cells, 2 broad groups of centromere-interacting proteins have been described: constitutively binding centromere proteins and 'passenger,' or transiently interacting, proteins (reviewed by Choo, 1997). The constitutive proteins include CENPA (centromere protein A; MIM 117139), CENPB (MIM 117140), CENPC1 (MIM 117141), and CENPD (MIM 117142). The term 'passenger proteins' encompasses a broad collection of proteins that localize to the centromere during specific stages of the cell cycle (Earnshaw and Mackay, 1994 [PubMed 8088460]). These include CENPE (MIM 117143); MCAK (MIM 604538); KID (MIM 603213); cytoplasmic dynein (e.g., MIM 600112); CliPs (e.g., MIM 179838); and CENPF/mitosin (MIM 600236). The inner centromere proteins (INCENPs) (Earnshaw and Cooke, 1991 [PubMed 1860899]), the initial members of the passenger protein group, display a broad localization along chromosomes in the early stages of mitosis but gradually become concentrated at centromeres as the cell cycle progresses into mid-metaphase. During telophase, the proteins are located within the midbody in the intercellular bridge, where they are discarded after cytokinesis (Cutts et al., 1999 [PubMed 10369859]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutant embryos die before E8.5. Embryonic cells exhibit abnormal nuclei and abberent mitosis. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(9)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik GCC GC 13: 59,691,598 probably null Het
Adam6a A G 12: 113,544,756 M250V probably benign Het
Adgre5 C A 8: 83,729,405 R254L probably benign Het
Adgrv1 A T 13: 81,559,552 L525Q probably damaging Het
Ano9 T A 7: 141,108,297 I205F probably benign Het
Bmp5 T C 9: 75,839,595 V245A probably benign Het
Capn8 T C 1: 182,613,467 S489P probably damaging Het
Ccdc85a A G 11: 28,583,316 L76P probably damaging Het
Cd164l2 A G 4: 133,221,499 T49A probably benign Het
Cdc25c T C 18: 34,747,295 T129A probably damaging Het
Cfap43 T C 19: 47,773,114 D847G probably benign Het
Crim1 G A 17: 78,200,799 A11T probably benign Het
Cul9 A T 17: 46,521,156 L1449H possibly damaging Het
Cyp2a22 T A 7: 26,936,311 K276* probably null Het
Cyp2c50 C A 19: 40,111,415 T430K possibly damaging Het
Ddb2 C T 2: 91,234,250 R105Q probably benign Het
Emilin1 T C 5: 30,920,199 Y900H probably benign Het
Eml3 T C 19: 8,936,637 F100L probably damaging Het
Eps8l2 G A 7: 141,361,057 G542D probably damaging Het
Fbf1 A G 11: 116,151,017 probably null Het
Gm21886 T C 18: 80,089,739 Y68C probably damaging Het
H2-Q10 A G 17: 35,473,595 probably benign Het
Hebp2 G T 10: 18,544,415 T90K possibly damaging Het
Il1rl2 A G 1: 40,343,160 T211A probably benign Het
Isg20l2 T A 3: 87,932,085 M201K probably damaging Het
Kansl1 A T 11: 104,423,996 S405R probably damaging Het
Kdsr T A 1: 106,753,226 I81F probably benign Het
Leprotl1 T G 8: 34,140,832 L7F probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Mtmr2 T A 9: 13,789,077 I60K probably damaging Het
Mto1 A G 9: 78,464,963 T572A probably benign Het
Nipbl G A 15: 8,302,912 T2287I probably benign Het
Nutm2 A G 13: 50,469,386 T40A probably benign Het
Nxf1 T C 19: 8,769,074 S550P probably benign Het
Olfr481 A T 7: 108,081,652 N286I probably damaging Het
Phactr1 G A 13: 43,057,280 V193I possibly damaging Het
Phactr1 A T 13: 43,094,781 Y317F possibly damaging Het
Pih1d1 T C 7: 45,159,826 probably null Het
Rictor T C 15: 6,768,090 I309T possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ruvbl2 T C 7: 45,424,967 D216G probably damaging Het
Slc20a2 T G 8: 22,538,830 S106A possibly damaging Het
Srprb A G 9: 103,192,207 probably benign Het
Stx11 A T 10: 12,941,836 I48N probably damaging Het
Vmn1r29 A T 6: 58,308,018 Y241F probably damaging Het
Wdfy1 A T 1: 79,707,475 C347* probably null Het
Zfp683 T C 4: 134,058,645 V361A possibly damaging Het
Other mutations in Incenp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Incenp APN 19 9883728 missense unknown
IGL01717:Incenp APN 19 9893265 splice site probably benign
IGL02485:Incenp APN 19 9893368 missense unknown
IGL02488:Incenp APN 19 9893407 missense unknown
B5639:Incenp UTSW 19 9893818 missense unknown
R0060:Incenp UTSW 19 9885459 splice site probably benign
R0164:Incenp UTSW 19 9894879 missense probably benign 0.23
R0164:Incenp UTSW 19 9894879 missense probably benign 0.23
R0242:Incenp UTSW 19 9893750 missense unknown
R0242:Incenp UTSW 19 9893750 missense unknown
R0284:Incenp UTSW 19 9893993 missense unknown
R1264:Incenp UTSW 19 9884015 missense unknown
R1432:Incenp UTSW 19 9885526 missense unknown
R1827:Incenp UTSW 19 9872729 missense possibly damaging 0.94
R1970:Incenp UTSW 19 9885487 missense unknown
R3082:Incenp UTSW 19 9883779 missense unknown
R3083:Incenp UTSW 19 9883779 missense unknown
R4062:Incenp UTSW 19 9883778 missense unknown
R4063:Incenp UTSW 19 9883778 missense unknown
R4534:Incenp UTSW 19 9883939 missense unknown
R4535:Incenp UTSW 19 9883939 missense unknown
R4536:Incenp UTSW 19 9883939 missense unknown
R4709:Incenp UTSW 19 9876600 missense unknown
R4785:Incenp UTSW 19 9877690 missense unknown
R4785:Incenp UTSW 19 9877691 missense unknown
R5179:Incenp UTSW 19 9894909 missense unknown
R5282:Incenp UTSW 19 9878406 missense unknown
R5400:Incenp UTSW 19 9877675 critical splice donor site probably null
R5502:Incenp UTSW 19 9893364 missense unknown
R5608:Incenp UTSW 19 9893868 small insertion probably benign
R6033:Incenp UTSW 19 9872697 missense probably damaging 0.99
R6033:Incenp UTSW 19 9872697 missense probably damaging 0.99
R6807:Incenp UTSW 19 9877756 missense unknown
R6885:Incenp UTSW 19 9875132 missense unknown
R6959:Incenp UTSW 19 9876770 missense unknown
R7033:Incenp UTSW 19 9893372 missense unknown
R8258:Incenp UTSW 19 9893629 missense unknown
R8258:Incenp UTSW 19 9893641 missense unknown
R8259:Incenp UTSW 19 9893629 missense unknown
R8259:Incenp UTSW 19 9893641 missense unknown
R8293:Incenp UTSW 19 9875133 nonsense probably null
R9005:Incenp UTSW 19 9877724 nonsense probably null
R9491:Incenp UTSW 19 9876777 missense unknown
Z1176:Incenp UTSW 19 9877687 missense unknown
Z1177:Incenp UTSW 19 9899364 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AGGCACTTAGGAAGGAACCCTGAC -3'
(R):5'- ACGGCATGGTGTTTCTCCTTGATTC -3'

Sequencing Primer
(F):5'- CTTAGGAAGGAACCCTGACCTATG -3'
(R):5'- ACAAGTGGCTCTGTCCTAAG -3'
Posted On 2014-05-09