Incidental Mutation 'R1680:Il1rl2'
ID 188381
Institutional Source Beutler Lab
Gene Symbol Il1rl2
Ensembl Gene ENSMUSG00000070942
Gene Name interleukin 1 receptor-like 2
Synonyms
MMRRC Submission 039716-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1680 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 40324610-40367562 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 40351793 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 299 (Y299H)
Ref Sequence ENSEMBL: ENSMUSP00000142248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095020] [ENSMUST00000194296]
AlphaFold Q9ERS7
Predicted Effect possibly damaging
Transcript: ENSMUST00000095020
AA Change: Y299H

PolyPhen 2 Score 0.614 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000092630
Gene: ENSMUSG00000070942
AA Change: Y299H

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
IG 29 115 7.52e-8 SMART
IG 134 219 1.94e-1 SMART
IG_like 237 333 2.39e1 SMART
transmembrane domain 340 362 N/A INTRINSIC
TIR 385 542 5.05e-33 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192199
Predicted Effect possibly damaging
Transcript: ENSMUST00000194296
AA Change: Y299H

PolyPhen 2 Score 0.614 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000142248
Gene: ENSMUSG00000070942
AA Change: Y299H

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
IG 29 115 7.52e-8 SMART
IG 134 219 1.94e-1 SMART
IG_like 237 333 2.39e1 SMART
transmembrane domain 340 362 N/A INTRINSIC
TIR 385 542 5.05e-33 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the interleukin 1 receptor family. An experiment with transient gene expression demonstrated that this receptor was incapable of binding to interleukin 1 alpha and interleukin 1 beta with high affinity. This gene and four other interleukin 1 receptor family genes, including interleukin 1 receptor, type I (IL1R1), interleukin 1 receptor, type II (IL1R2), interleukin 1 receptor-like 1 (IL1RL1), and interleukin 18 receptor 1 (IL18R1), form a cytokine receptor gene cluster in a region mapped to chromosome 2q12. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele are viable and overtly normal and have normal skin in an unchallenged context. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik C G 10: 100,603,528 P187R probably damaging Het
Ahnak T A 19: 9,009,963 H2870Q probably benign Het
Arhgef33 C T 17: 80,347,651 S95F probably damaging Het
Atp1a2 T A 1: 172,278,954 D827V probably damaging Het
Bcat1 T G 6: 145,039,628 D96A probably damaging Het
Birc6 A T 17: 74,548,746 I184L probably benign Het
Ccdc129 C T 6: 55,968,766 T824I probably damaging Het
Clca3b A T 3: 144,837,824 L415M probably damaging Het
Clstn1 T C 4: 149,643,726 V617A probably benign Het
Col22a1 G A 15: 71,799,361 A1050V unknown Het
Col5a3 C T 9: 20,784,668 probably null Het
Csmd3 G A 15: 47,741,170 T1059I probably damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dnm3 A G 1: 162,010,976 V272A probably benign Het
Dnmt3a A G 12: 3,873,361 Q187R probably damaging Het
Dpp9 A G 17: 56,190,103 Y710H probably benign Het
Eef1a2 A T 2: 181,152,941 M155K possibly damaging Het
Entpd8 G A 2: 25,084,024 C331Y probably damaging Het
Erc1 A C 6: 119,575,761 L1072R probably damaging Het
Fam160b2 T C 14: 70,586,851 Y482C probably damaging Het
Gtf3c2 A G 5: 31,173,868 S155P probably damaging Het
Gucy2c A G 6: 136,722,493 S617P probably damaging Het
Ice1 T C 13: 70,605,448 R840G probably benign Het
Ints7 T G 1: 191,621,162 probably null Het
Ireb2 C T 9: 54,881,518 T92I probably damaging Het
Kcnj8 A T 6: 142,570,189 L64* probably null Het
Mapk8ip3 A G 17: 24,901,011 V983A probably damaging Het
Mertk A G 2: 128,801,636 D985G probably benign Het
Mical3 A T 6: 120,959,643 S1307R probably benign Het
Ncaph2 A G 15: 89,364,622 D222G probably benign Het
Nf1 C A 11: 79,550,998 S295* probably null Het
Nlrp12 T A 7: 3,241,174 D236V probably damaging Het
Npnt A G 3: 132,906,802 V74A probably benign Het
Oasl1 A G 5: 114,935,944 D304G probably damaging Het
Olfr1098 C T 2: 86,923,161 V124I probably benign Het
Olfr556 A G 7: 102,670,733 D271G possibly damaging Het
Olfr834 A G 9: 18,988,516 H176R possibly damaging Het
Olfr936 T C 9: 39,047,000 I140V probably benign Het
Patz1 A G 11: 3,307,812 K604E probably damaging Het
Pcsk6 T A 7: 66,035,250 V793E probably benign Het
Pla2g4d C T 2: 120,277,750 probably null Het
Plxnc1 A C 10: 94,841,551 L938R probably benign Het
Pou4f2 G T 8: 78,434,831 A381D probably damaging Het
Prdm4 A G 10: 85,899,223 L685P possibly damaging Het
Pxn T A 5: 115,552,147 V383E probably damaging Het
Rbl1 A G 2: 157,174,783 L632P probably damaging Het
Rnf135 T A 11: 80,196,881 S219T possibly damaging Het
Sdk2 T C 11: 113,791,436 D2039G possibly damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Slc5a6 A G 5: 31,042,644 Y131H probably damaging Het
Slc9a1 T C 4: 133,418,080 I492T probably damaging Het
Soga3 A T 10: 29,196,839 Q709L probably damaging Het
Spag5 A G 11: 78,320,616 K993E probably damaging Het
Sptbn1 T G 11: 30,159,371 I75L possibly damaging Het
Syngap1 T C 17: 26,952,579 S46P possibly damaging Het
Tfcp2l1 T A 1: 118,675,605 F458I probably damaging Het
Tmem67 A G 4: 12,087,840 V102A probably benign Het
Tomm70a T C 16: 57,121,961 S34P unknown Het
Txlnb G T 10: 17,843,233 G604V probably benign Het
Ube2q1 A G 3: 89,776,176 T143A probably benign Het
Unc80 C T 1: 66,503,669 R361* probably null Het
Vcan T C 13: 89,703,547 D1098G probably benign Het
Vmn1r176 T A 7: 23,835,381 T116S probably damaging Het
Wdr81 C T 11: 75,454,423 R6K probably benign Het
Zan T A 5: 137,403,050 T4136S unknown Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp606 A T 7: 12,493,971 H615L probably damaging Het
Zp3r A T 1: 130,582,880 N433K probably benign Het
Other mutations in Il1rl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01631:Il1rl2 APN 1 40356814 splice site probably null
IGL02490:Il1rl2 APN 1 40356812 splice site probably benign
IGL03201:Il1rl2 APN 1 40343040 missense possibly damaging 0.95
IGL03269:Il1rl2 APN 1 40365312 missense probably damaging 1.00
R0088:Il1rl2 UTSW 1 40365053 missense possibly damaging 0.87
R0418:Il1rl2 UTSW 1 40326502 missense unknown
R0504:Il1rl2 UTSW 1 40329056 missense probably benign 0.00
R1629:Il1rl2 UTSW 1 40356860 missense probably benign 0.02
R1679:Il1rl2 UTSW 1 40343160 missense probably benign 0.36
R1892:Il1rl2 UTSW 1 40327534 missense probably damaging 1.00
R1938:Il1rl2 UTSW 1 40363324 missense probably damaging 1.00
R2020:Il1rl2 UTSW 1 40365214 missense probably damaging 0.98
R4193:Il1rl2 UTSW 1 40365048 missense probably damaging 1.00
R4364:Il1rl2 UTSW 1 40351791 missense probably benign
R4365:Il1rl2 UTSW 1 40351791 missense probably benign
R4657:Il1rl2 UTSW 1 40327310 intron probably benign
R4840:Il1rl2 UTSW 1 40327387 missense possibly damaging 0.84
R4890:Il1rl2 UTSW 1 40327310 intron probably benign
R5051:Il1rl2 UTSW 1 40343094 missense probably benign 0.03
R5239:Il1rl2 UTSW 1 40365095 missense probably benign 0.03
R5447:Il1rl2 UTSW 1 40329156 missense probably damaging 1.00
R6013:Il1rl2 UTSW 1 40351857 missense possibly damaging 0.82
R6162:Il1rl2 UTSW 1 40351878 missense probably damaging 1.00
R6244:Il1rl2 UTSW 1 40327566 missense possibly damaging 0.78
R6798:Il1rl2 UTSW 1 40365240 missense probably damaging 1.00
R7667:Il1rl2 UTSW 1 40365253 missense probably damaging 0.99
R7855:Il1rl2 UTSW 1 40343119 missense probably damaging 1.00
R7857:Il1rl2 UTSW 1 40327482 missense probably benign 0.44
R8255:Il1rl2 UTSW 1 40365311 missense probably damaging 1.00
R8903:Il1rl2 UTSW 1 40327370 critical splice acceptor site probably null
R9236:Il1rl2 UTSW 1 40329061 missense probably damaging 1.00
R9448:Il1rl2 UTSW 1 40327444 missense probably benign 0.36
Z1177:Il1rl2 UTSW 1 40327310 intron probably benign
Predicted Primers PCR Primer
(F):5'- ATTCAAATCCAGCCTGACCCTGTG -3'
(R):5'- TTTTCAATGCTCTGAGCAGCAGGTG -3'

Sequencing Primer
(F):5'- TGCTGTAGTTAGCAGAACCAC -3'
(R):5'- AGGTGACATGCCGGGTATTAC -3'
Posted On 2014-05-09