Incidental Mutation 'R1680:Unc80'
ID 188382
Institutional Source Beutler Lab
Gene Symbol Unc80
Ensembl Gene ENSMUSG00000055567
Gene Name unc-80, NALCN activator
Synonyms C030018G13Rik, C230061B10Rik
MMRRC Submission 039716-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.920) question?
Stock # R1680 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 66468367-66699148 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 66503669 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 361 (R361*)
Ref Sequence ENSEMBL: ENSMUSP00000148517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061620] [ENSMUST00000114008] [ENSMUST00000212557]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000061620
AA Change: R361*
SMART Domains Protein: ENSMUSP00000053692
Gene: ENSMUSG00000055567
AA Change: R361*

DomainStartEndE-ValueType
Pfam:UNC80 16 236 2.2e-94 PFAM
low complexity region 372 385 N/A INTRINSIC
low complexity region 493 502 N/A INTRINSIC
low complexity region 693 711 N/A INTRINSIC
low complexity region 723 738 N/A INTRINSIC
low complexity region 739 769 N/A INTRINSIC
low complexity region 1038 1055 N/A INTRINSIC
low complexity region 1067 1084 N/A INTRINSIC
low complexity region 1309 1328 N/A INTRINSIC
low complexity region 1477 1489 N/A INTRINSIC
low complexity region 1676 1681 N/A INTRINSIC
low complexity region 1842 1848 N/A INTRINSIC
low complexity region 1854 1868 N/A INTRINSIC
low complexity region 2461 2480 N/A INTRINSIC
low complexity region 2726 2740 N/A INTRINSIC
low complexity region 3121 3144 N/A INTRINSIC
low complexity region 3245 3254 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114008
Predicted Effect probably null
Transcript: ENSMUST00000212557
AA Change: R361*
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of a voltage-independent 'leak' ion-channel complex, in which it performs essential functions, such as serving as a bridge between two other components (sodium leak channel non-selective and UNC79) and as a scaffold for Src kinases. Leak channels play an importnat role in establishment and maintenance of resting membrane potentials in neurons. Mutations in this gene are associated with congenital infantile encephalopathy, intellectual disability and growth issues. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik C G 10: 100,603,528 P187R probably damaging Het
Ahnak T A 19: 9,009,963 H2870Q probably benign Het
Arhgef33 C T 17: 80,347,651 S95F probably damaging Het
Atp1a2 T A 1: 172,278,954 D827V probably damaging Het
Bcat1 T G 6: 145,039,628 D96A probably damaging Het
Birc6 A T 17: 74,548,746 I184L probably benign Het
Ccdc129 C T 6: 55,968,766 T824I probably damaging Het
Clca3b A T 3: 144,837,824 L415M probably damaging Het
Clstn1 T C 4: 149,643,726 V617A probably benign Het
Col22a1 G A 15: 71,799,361 A1050V unknown Het
Col5a3 C T 9: 20,784,668 probably null Het
Csmd3 G A 15: 47,741,170 T1059I probably damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dnm3 A G 1: 162,010,976 V272A probably benign Het
Dnmt3a A G 12: 3,873,361 Q187R probably damaging Het
Dpp9 A G 17: 56,190,103 Y710H probably benign Het
Eef1a2 A T 2: 181,152,941 M155K possibly damaging Het
Entpd8 G A 2: 25,084,024 C331Y probably damaging Het
Erc1 A C 6: 119,575,761 L1072R probably damaging Het
Fam160b2 T C 14: 70,586,851 Y482C probably damaging Het
Gtf3c2 A G 5: 31,173,868 S155P probably damaging Het
Gucy2c A G 6: 136,722,493 S617P probably damaging Het
Ice1 T C 13: 70,605,448 R840G probably benign Het
Il1rl2 T C 1: 40,351,793 Y299H possibly damaging Het
Ints7 T G 1: 191,621,162 probably null Het
Ireb2 C T 9: 54,881,518 T92I probably damaging Het
Kcnj8 A T 6: 142,570,189 L64* probably null Het
Mapk8ip3 A G 17: 24,901,011 V983A probably damaging Het
Mertk A G 2: 128,801,636 D985G probably benign Het
Mical3 A T 6: 120,959,643 S1307R probably benign Het
Ncaph2 A G 15: 89,364,622 D222G probably benign Het
Nf1 C A 11: 79,550,998 S295* probably null Het
Nlrp12 T A 7: 3,241,174 D236V probably damaging Het
Npnt A G 3: 132,906,802 V74A probably benign Het
Oasl1 A G 5: 114,935,944 D304G probably damaging Het
Olfr1098 C T 2: 86,923,161 V124I probably benign Het
Olfr556 A G 7: 102,670,733 D271G possibly damaging Het
Olfr834 A G 9: 18,988,516 H176R possibly damaging Het
Olfr936 T C 9: 39,047,000 I140V probably benign Het
Patz1 A G 11: 3,307,812 K604E probably damaging Het
Pcsk6 T A 7: 66,035,250 V793E probably benign Het
Pla2g4d C T 2: 120,277,750 probably null Het
Plxnc1 A C 10: 94,841,551 L938R probably benign Het
Pou4f2 G T 8: 78,434,831 A381D probably damaging Het
Prdm4 A G 10: 85,899,223 L685P possibly damaging Het
Pxn T A 5: 115,552,147 V383E probably damaging Het
Rbl1 A G 2: 157,174,783 L632P probably damaging Het
Rnf135 T A 11: 80,196,881 S219T possibly damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Sdk2 T C 11: 113,791,436 D2039G possibly damaging Het
Slc5a6 A G 5: 31,042,644 Y131H probably damaging Het
Slc9a1 T C 4: 133,418,080 I492T probably damaging Het
Soga3 A T 10: 29,196,839 Q709L probably damaging Het
Spag5 A G 11: 78,320,616 K993E probably damaging Het
Sptbn1 T G 11: 30,159,371 I75L possibly damaging Het
Syngap1 T C 17: 26,952,579 S46P possibly damaging Het
Tfcp2l1 T A 1: 118,675,605 F458I probably damaging Het
Tmem67 A G 4: 12,087,840 V102A probably benign Het
Tomm70a T C 16: 57,121,961 S34P unknown Het
Txlnb G T 10: 17,843,233 G604V probably benign Het
Ube2q1 A G 3: 89,776,176 T143A probably benign Het
Vcan T C 13: 89,703,547 D1098G probably benign Het
Vmn1r176 T A 7: 23,835,381 T116S probably damaging Het
Wdr81 C T 11: 75,454,423 R6K probably benign Het
Zan T A 5: 137,403,050 T4136S unknown Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp606 A T 7: 12,493,971 H615L probably damaging Het
Zp3r A T 1: 130,582,880 N433K probably benign Het
Other mutations in Unc80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Unc80 APN 1 66,654,395 (GRCm38) missense possibly damaging 0.53
IGL00340:Unc80 APN 1 66,606,459 (GRCm38) missense possibly damaging 0.73
IGL00783:Unc80 APN 1 66,608,437 (GRCm38) missense probably benign 0.37
IGL00784:Unc80 APN 1 66,608,437 (GRCm38) missense probably benign 0.37
IGL00935:Unc80 APN 1 66,627,266 (GRCm38) missense possibly damaging 0.53
IGL01094:Unc80 APN 1 66,695,433 (GRCm38) missense possibly damaging 0.90
IGL01466:Unc80 APN 1 66,622,486 (GRCm38) missense probably benign 0.33
IGL01577:Unc80 APN 1 66,529,968 (GRCm38) splice site probably null
IGL01626:Unc80 APN 1 66,551,054 (GRCm38) critical splice donor site probably null
IGL01640:Unc80 APN 1 66,679,585 (GRCm38) missense probably benign 0.33
IGL01775:Unc80 APN 1 66,601,056 (GRCm38) missense possibly damaging 0.94
IGL01960:Unc80 APN 1 66,608,500 (GRCm38) splice site probably benign
IGL01991:Unc80 APN 1 66,469,509 (GRCm38) nonsense probably null
IGL02022:Unc80 APN 1 66,626,516 (GRCm38) missense possibly damaging 0.53
IGL02073:Unc80 APN 1 66,612,227 (GRCm38) missense possibly damaging 0.85
IGL02077:Unc80 APN 1 66,525,716 (GRCm38) missense possibly damaging 0.77
IGL02197:Unc80 APN 1 66,530,065 (GRCm38) missense probably benign 0.39
IGL02198:Unc80 APN 1 66,529,986 (GRCm38) missense possibly damaging 0.88
IGL02228:Unc80 APN 1 66,608,428 (GRCm38) missense possibly damaging 0.72
IGL02327:Unc80 APN 1 66,641,673 (GRCm38) missense probably benign 0.33
IGL02447:Unc80 APN 1 66,503,544 (GRCm38) missense possibly damaging 0.86
IGL02489:Unc80 APN 1 66,525,701 (GRCm38) missense probably benign 0.07
IGL02546:Unc80 APN 1 66,554,953 (GRCm38) missense possibly damaging 0.83
IGL02629:Unc80 APN 1 66,483,317 (GRCm38) missense possibly damaging 0.46
IGL02631:Unc80 APN 1 66,530,063 (GRCm38) missense probably damaging 0.98
IGL02839:Unc80 APN 1 66,671,675 (GRCm38) missense possibly damaging 0.53
IGL02960:Unc80 APN 1 66,678,058 (GRCm38) splice site probably benign
IGL02974:Unc80 APN 1 66,525,658 (GRCm38) missense possibly damaging 0.95
IGL03060:Unc80 APN 1 66,637,010 (GRCm38) missense possibly damaging 0.96
IGL03062:Unc80 APN 1 66,509,489 (GRCm38) missense probably damaging 0.96
IGL03074:Unc80 APN 1 66,671,718 (GRCm38) splice site probably benign
IGL03086:Unc80 APN 1 66,509,474 (GRCm38) missense probably damaging 0.99
IGL03105:Unc80 APN 1 66,472,099 (GRCm38) missense probably damaging 0.96
IGL03107:Unc80 APN 1 66,631,454 (GRCm38) missense probably damaging 0.98
IGL03158:Unc80 APN 1 66,641,674 (GRCm38) missense probably benign 0.33
IGL03220:Unc80 APN 1 66,504,938 (GRCm38) missense probably damaging 0.99
IGL03271:Unc80 APN 1 66,695,603 (GRCm38) unclassified probably benign
IGL03332:Unc80 APN 1 66,503,631 (GRCm38) missense probably damaging 1.00
IGL03347:Unc80 APN 1 66,695,466 (GRCm38) missense probably damaging 1.00
R0012:Unc80 UTSW 1 66,507,391 (GRCm38) missense probably damaging 1.00
R0012:Unc80 UTSW 1 66,507,391 (GRCm38) missense probably damaging 1.00
R0026:Unc80 UTSW 1 66,521,584 (GRCm38) missense probably benign 0.27
R0055:Unc80 UTSW 1 66,506,623 (GRCm38) splice site probably benign
R0149:Unc80 UTSW 1 66,521,601 (GRCm38) missense possibly damaging 0.82
R0325:Unc80 UTSW 1 66,510,881 (GRCm38) missense probably damaging 1.00
R0329:Unc80 UTSW 1 66,674,087 (GRCm38) missense possibly damaging 0.96
R0330:Unc80 UTSW 1 66,674,087 (GRCm38) missense possibly damaging 0.96
R0355:Unc80 UTSW 1 66,549,856 (GRCm38) missense possibly damaging 0.77
R0412:Unc80 UTSW 1 66,550,937 (GRCm38) splice site probably benign
R0422:Unc80 UTSW 1 66,483,338 (GRCm38) missense probably damaging 1.00
R0477:Unc80 UTSW 1 66,570,001 (GRCm38) missense probably damaging 0.99
R0507:Unc80 UTSW 1 66,527,893 (GRCm38) missense possibly damaging 0.66
R0513:Unc80 UTSW 1 66,622,474 (GRCm38) missense possibly damaging 0.73
R0553:Unc80 UTSW 1 66,506,669 (GRCm38) missense probably damaging 0.97
R0626:Unc80 UTSW 1 66,608,442 (GRCm38) missense probably benign 0.01
R0655:Unc80 UTSW 1 66,503,781 (GRCm38) missense probably damaging 0.98
R0742:Unc80 UTSW 1 66,527,893 (GRCm38) missense possibly damaging 0.66
R0755:Unc80 UTSW 1 66,504,923 (GRCm38) missense probably damaging 1.00
R0782:Unc80 UTSW 1 66,622,581 (GRCm38) missense possibly damaging 0.53
R0837:Unc80 UTSW 1 66,648,944 (GRCm38) missense possibly damaging 0.73
R0841:Unc80 UTSW 1 66,472,088 (GRCm38) missense probably damaging 1.00
R0893:Unc80 UTSW 1 66,521,486 (GRCm38) missense probably damaging 0.97
R0900:Unc80 UTSW 1 66,671,598 (GRCm38) missense probably benign 0.33
R0924:Unc80 UTSW 1 66,510,641 (GRCm38) missense possibly damaging 0.95
R0930:Unc80 UTSW 1 66,510,641 (GRCm38) missense possibly damaging 0.95
R0989:Unc80 UTSW 1 66,646,440 (GRCm38) missense possibly damaging 0.53
R1145:Unc80 UTSW 1 66,472,088 (GRCm38) missense probably damaging 1.00
R1145:Unc80 UTSW 1 66,472,088 (GRCm38) missense probably damaging 1.00
R1224:Unc80 UTSW 1 66,471,980 (GRCm38) missense probably damaging 1.00
R1240:Unc80 UTSW 1 66,635,902 (GRCm38) missense possibly damaging 0.85
R1245:Unc80 UTSW 1 66,555,095 (GRCm38) missense possibly damaging 0.94
R1467:Unc80 UTSW 1 66,521,581 (GRCm38) missense possibly damaging 0.46
R1473:Unc80 UTSW 1 66,521,581 (GRCm38) missense possibly damaging 0.46
R1500:Unc80 UTSW 1 66,521,581 (GRCm38) missense possibly damaging 0.46
R1556:Unc80 UTSW 1 66,521,581 (GRCm38) missense possibly damaging 0.46
R1562:Unc80 UTSW 1 66,637,957 (GRCm38) missense probably damaging 1.00
R1655:Unc80 UTSW 1 66,672,756 (GRCm38) missense possibly damaging 0.86
R1674:Unc80 UTSW 1 66,509,308 (GRCm38) missense probably damaging 1.00
R1739:Unc80 UTSW 1 66,527,892 (GRCm38) missense probably damaging 0.97
R1756:Unc80 UTSW 1 66,639,248 (GRCm38) missense possibly damaging 0.53
R1783:Unc80 UTSW 1 66,683,273 (GRCm38) missense probably benign 0.01
R1834:Unc80 UTSW 1 66,639,248 (GRCm38) missense possibly damaging 0.53
R1854:Unc80 UTSW 1 66,631,414 (GRCm38) missense possibly damaging 0.93
R1871:Unc80 UTSW 1 66,510,717 (GRCm38) missense possibly damaging 0.77
R1878:Unc80 UTSW 1 66,509,402 (GRCm38) missense probably damaging 0.96
R1883:Unc80 UTSW 1 66,525,770 (GRCm38) missense possibly damaging 0.89
R1912:Unc80 UTSW 1 66,510,625 (GRCm38) missense probably damaging 1.00
R1990:Unc80 UTSW 1 66,692,549 (GRCm38) missense probably damaging 0.97
R2007:Unc80 UTSW 1 66,503,776 (GRCm38) missense probably damaging 1.00
R2035:Unc80 UTSW 1 66,606,593 (GRCm38) missense probably damaging 0.98
R2056:Unc80 UTSW 1 66,640,552 (GRCm38) missense possibly damaging 0.72
R2060:Unc80 UTSW 1 66,640,595 (GRCm38) missense possibly damaging 0.53
R2074:Unc80 UTSW 1 66,679,744 (GRCm38) critical splice donor site probably null
R2088:Unc80 UTSW 1 66,590,227 (GRCm38) missense possibly damaging 0.77
R2089:Unc80 UTSW 1 66,671,715 (GRCm38) splice site probably benign
R2091:Unc80 UTSW 1 66,671,715 (GRCm38) splice site probably benign
R2139:Unc80 UTSW 1 66,521,581 (GRCm38) missense possibly damaging 0.46
R2169:Unc80 UTSW 1 66,521,581 (GRCm38) missense possibly damaging 0.46
R2175:Unc80 UTSW 1 66,677,355 (GRCm38) missense probably damaging 1.00
R2248:Unc80 UTSW 1 66,623,206 (GRCm38) splice site probably benign
R2255:Unc80 UTSW 1 66,618,258 (GRCm38) missense possibly damaging 0.53
R2308:Unc80 UTSW 1 66,648,997 (GRCm38) missense possibly damaging 0.53
R2484:Unc80 UTSW 1 66,521,581 (GRCm38) missense possibly damaging 0.46
R2507:Unc80 UTSW 1 66,612,107 (GRCm38) missense possibly damaging 0.53
R2512:Unc80 UTSW 1 66,671,608 (GRCm38) missense possibly damaging 0.70
R2878:Unc80 UTSW 1 66,671,576 (GRCm38) critical splice acceptor site probably benign
R3040:Unc80 UTSW 1 66,639,305 (GRCm38) missense probably benign 0.33
R3104:Unc80 UTSW 1 66,623,291 (GRCm38) missense probably benign 0.33
R3402:Unc80 UTSW 1 66,510,686 (GRCm38) missense probably damaging 0.97
R3403:Unc80 UTSW 1 66,510,686 (GRCm38) missense probably damaging 0.97
R3413:Unc80 UTSW 1 66,639,305 (GRCm38) missense probably benign 0.33
R3426:Unc80 UTSW 1 66,639,305 (GRCm38) missense probably benign 0.33
R3427:Unc80 UTSW 1 66,639,305 (GRCm38) missense probably benign 0.33
R3428:Unc80 UTSW 1 66,639,305 (GRCm38) missense probably benign 0.33
R3904:Unc80 UTSW 1 66,639,296 (GRCm38) nonsense probably null
R3916:Unc80 UTSW 1 66,677,495 (GRCm38) missense probably benign 0.11
R3950:Unc80 UTSW 1 66,622,570 (GRCm38) missense possibly damaging 0.53
R4642:Unc80 UTSW 1 66,671,714 (GRCm38) splice site probably null
R4646:Unc80 UTSW 1 66,669,235 (GRCm38) missense probably benign 0.03
R4655:Unc80 UTSW 1 66,671,662 (GRCm38) missense probably benign 0.18
R4662:Unc80 UTSW 1 66,646,436 (GRCm38) missense probably benign 0.01
R4720:Unc80 UTSW 1 66,510,792 (GRCm38) missense possibly damaging 0.92
R4736:Unc80 UTSW 1 66,649,672 (GRCm38) critical splice acceptor site probably null
R4795:Unc80 UTSW 1 66,527,941 (GRCm38) missense probably damaging 0.97
R4888:Unc80 UTSW 1 66,644,447 (GRCm38) missense probably damaging 0.98
R4917:Unc80 UTSW 1 66,646,550 (GRCm38) missense possibly damaging 0.86
R4918:Unc80 UTSW 1 66,646,550 (GRCm38) missense possibly damaging 0.86
R4983:Unc80 UTSW 1 66,674,732 (GRCm38) splice site probably null
R5051:Unc80 UTSW 1 66,509,477 (GRCm38) missense probably damaging 0.96
R5111:Unc80 UTSW 1 66,527,995 (GRCm38) missense possibly damaging 0.66
R5122:Unc80 UTSW 1 66,679,590 (GRCm38) missense possibly damaging 0.53
R5260:Unc80 UTSW 1 66,646,587 (GRCm38) missense possibly damaging 0.53
R5351:Unc80 UTSW 1 66,606,513 (GRCm38) missense possibly damaging 0.73
R5387:Unc80 UTSW 1 66,530,021 (GRCm38) missense possibly damaging 0.77
R5437:Unc80 UTSW 1 66,654,578 (GRCm38) missense possibly damaging 0.96
R5525:Unc80 UTSW 1 66,606,614 (GRCm38) missense possibly damaging 0.72
R5621:Unc80 UTSW 1 66,638,043 (GRCm38) missense possibly damaging 0.53
R5690:Unc80 UTSW 1 66,640,572 (GRCm38) missense probably benign 0.08
R5762:Unc80 UTSW 1 66,693,796 (GRCm38) missense possibly damaging 0.82
R5956:Unc80 UTSW 1 66,527,964 (GRCm38) missense probably damaging 0.97
R6005:Unc80 UTSW 1 66,627,257 (GRCm38) missense possibly damaging 0.53
R6025:Unc80 UTSW 1 66,695,568 (GRCm38) missense possibly damaging 0.90
R6033:Unc80 UTSW 1 66,473,260 (GRCm38) missense possibly damaging 0.92
R6033:Unc80 UTSW 1 66,473,260 (GRCm38) missense possibly damaging 0.92
R6117:Unc80 UTSW 1 66,675,067 (GRCm38) missense possibly damaging 0.72
R6156:Unc80 UTSW 1 66,612,250 (GRCm38) missense probably benign 0.01
R6157:Unc80 UTSW 1 66,654,029 (GRCm38) nonsense probably null
R6189:Unc80 UTSW 1 66,677,471 (GRCm38) missense probably benign 0.33
R6291:Unc80 UTSW 1 66,521,597 (GRCm38) missense possibly damaging 0.82
R6367:Unc80 UTSW 1 66,672,766 (GRCm38) missense probably benign 0.33
R6598:Unc80 UTSW 1 66,468,540 (GRCm38) critical splice donor site probably null
R6724:Unc80 UTSW 1 66,683,191 (GRCm38) missense possibly damaging 0.90
R6763:Unc80 UTSW 1 66,521,477 (GRCm38) missense probably benign 0.00
R6773:Unc80 UTSW 1 66,651,543 (GRCm38) missense probably benign 0.33
R6883:Unc80 UTSW 1 66,646,404 (GRCm38) missense probably benign 0.33
R6951:Unc80 UTSW 1 66,648,511 (GRCm38) missense possibly damaging 0.53
R6965:Unc80 UTSW 1 66,646,566 (GRCm38) missense probably benign 0.33
R6993:Unc80 UTSW 1 66,549,793 (GRCm38) missense possibly damaging 0.60
R7041:Unc80 UTSW 1 66,503,593 (GRCm38) missense probably benign 0.00
R7050:Unc80 UTSW 1 66,550,908 (GRCm38) splice site probably null
R7067:Unc80 UTSW 1 66,646,572 (GRCm38) missense possibly damaging 0.86
R7080:Unc80 UTSW 1 66,646,521 (GRCm38) missense possibly damaging 0.53
R7193:Unc80 UTSW 1 66,549,784 (GRCm38) missense possibly damaging 0.60
R7197:Unc80 UTSW 1 66,521,566 (GRCm38) nonsense probably null
R7278:Unc80 UTSW 1 66,552,209 (GRCm38) missense possibly damaging 0.82
R7290:Unc80 UTSW 1 66,601,197 (GRCm38) missense probably damaging 0.97
R7391:Unc80 UTSW 1 66,695,528 (GRCm38) missense probably benign 0.18
R7401:Unc80 UTSW 1 66,646,415 (GRCm38) missense possibly damaging 0.96
R7470:Unc80 UTSW 1 66,622,462 (GRCm38) missense probably benign 0.02
R7573:Unc80 UTSW 1 66,521,537 (GRCm38) missense probably damaging 1.00
R7637:Unc80 UTSW 1 66,672,684 (GRCm38) missense possibly damaging 0.86
R7678:Unc80 UTSW 1 66,649,722 (GRCm38) missense probably benign 0.33
R7697:Unc80 UTSW 1 66,637,945 (GRCm38) missense possibly damaging 0.93
R7746:Unc80 UTSW 1 66,677,385 (GRCm38) missense probably benign 0.33
R7768:Unc80 UTSW 1 66,510,595 (GRCm38) missense possibly damaging 0.56
R7796:Unc80 UTSW 1 66,503,714 (GRCm38) missense probably benign
R7855:Unc80 UTSW 1 66,483,349 (GRCm38) missense possibly damaging 0.78
R7878:Unc80 UTSW 1 66,601,141 (GRCm38) missense possibly damaging 0.88
R7879:Unc80 UTSW 1 66,510,707 (GRCm38) missense probably benign 0.00
R8024:Unc80 UTSW 1 66,606,644 (GRCm38) missense possibly damaging 0.86
R8026:Unc80 UTSW 1 66,483,304 (GRCm38) missense possibly damaging 0.92
R8115:Unc80 UTSW 1 66,648,913 (GRCm38) missense probably benign 0.00
R8135:Unc80 UTSW 1 66,509,287 (GRCm38) missense possibly damaging 0.49
R8170:Unc80 UTSW 1 66,651,533 (GRCm38) missense probably benign 0.33
R8239:Unc80 UTSW 1 66,654,019 (GRCm38) missense probably benign
R8249:Unc80 UTSW 1 66,619,491 (GRCm38) missense probably benign 0.01
R8275:Unc80 UTSW 1 66,640,614 (GRCm38) nonsense probably null
R8288:Unc80 UTSW 1 66,473,350 (GRCm38) missense probably benign 0.07
R8341:Unc80 UTSW 1 66,649,033 (GRCm38) missense possibly damaging 0.73
R8356:Unc80 UTSW 1 66,641,629 (GRCm38) missense possibly damaging 0.85
R8433:Unc80 UTSW 1 66,638,028 (GRCm38) nonsense probably null
R8456:Unc80 UTSW 1 66,641,629 (GRCm38) missense possibly damaging 0.85
R8464:Unc80 UTSW 1 66,473,264 (GRCm38) missense probably damaging 1.00
R8483:Unc80 UTSW 1 66,693,710 (GRCm38) missense possibly damaging 0.83
R8509:Unc80 UTSW 1 66,641,629 (GRCm38) missense possibly damaging 0.85
R8686:Unc80 UTSW 1 66,612,268 (GRCm38) missense possibly damaging 0.53
R8701:Unc80 UTSW 1 66,638,032 (GRCm38) missense possibly damaging 0.85
R8729:Unc80 UTSW 1 66,608,490 (GRCm38) missense probably benign 0.01
R8755:Unc80 UTSW 1 66,612,131 (GRCm38) missense possibly damaging 0.53
R8771:Unc80 UTSW 1 66,646,395 (GRCm38) missense possibly damaging 0.85
R8866:Unc80 UTSW 1 66,590,229 (GRCm38) missense probably benign 0.05
R8877:Unc80 UTSW 1 66,527,985 (GRCm38) missense possibly damaging 0.89
R8942:Unc80 UTSW 1 66,473,309 (GRCm38) missense possibly damaging 0.94
R8976:Unc80 UTSW 1 66,472,010 (GRCm38) missense possibly damaging 0.87
R9063:Unc80 UTSW 1 66,606,657 (GRCm38) critical splice donor site probably null
R9095:Unc80 UTSW 1 66,506,753 (GRCm38) missense probably damaging 1.00
R9125:Unc80 UTSW 1 66,679,581 (GRCm38) missense probably benign 0.18
R9130:Unc80 UTSW 1 66,638,085 (GRCm38) missense possibly damaging 0.85
R9165:Unc80 UTSW 1 66,549,841 (GRCm38) missense probably null 0.95
R9220:Unc80 UTSW 1 66,507,375 (GRCm38) missense probably damaging 1.00
R9262:Unc80 UTSW 1 66,555,252 (GRCm38) intron probably benign
R9334:Unc80 UTSW 1 66,649,760 (GRCm38) missense possibly damaging 0.73
R9374:Unc80 UTSW 1 66,590,301 (GRCm38) missense possibly damaging 0.95
R9387:Unc80 UTSW 1 66,549,938 (GRCm38) critical splice donor site probably null
R9415:Unc80 UTSW 1 66,510,905 (GRCm38) missense
R9427:Unc80 UTSW 1 66,554,999 (GRCm38) missense probably damaging 1.00
R9436:Unc80 UTSW 1 66,693,805 (GRCm38) critical splice donor site probably null
R9454:Unc80 UTSW 1 66,695,590 (GRCm38) missense possibly damaging 0.53
R9522:Unc80 UTSW 1 66,638,062 (GRCm38) missense possibly damaging 0.73
R9539:Unc80 UTSW 1 66,570,004 (GRCm38) critical splice donor site probably null
R9552:Unc80 UTSW 1 66,678,123 (GRCm38) missense possibly damaging 0.85
R9667:Unc80 UTSW 1 66,612,128 (GRCm38) missense possibly damaging 0.86
R9720:Unc80 UTSW 1 66,644,326 (GRCm38) missense possibly damaging 0.53
R9749:Unc80 UTSW 1 66,505,020 (GRCm38) missense probably damaging 0.99
R9789:Unc80 UTSW 1 66,612,212 (GRCm38) missense possibly damaging 0.53
X0019:Unc80 UTSW 1 66,648,382 (GRCm38) missense probably benign 0.33
X0021:Unc80 UTSW 1 66,509,266 (GRCm38) critical splice acceptor site probably null
X0024:Unc80 UTSW 1 66,491,046 (GRCm38) missense probably benign 0.21
X0062:Unc80 UTSW 1 66,623,259 (GRCm38) missense probably benign 0.02
X0066:Unc80 UTSW 1 66,530,757 (GRCm38) missense possibly damaging 0.77
Y4335:Unc80 UTSW 1 66,521,581 (GRCm38) missense possibly damaging 0.46
Y4336:Unc80 UTSW 1 66,521,581 (GRCm38) missense possibly damaging 0.46
Y4338:Unc80 UTSW 1 66,521,581 (GRCm38) missense possibly damaging 0.46
Z1088:Unc80 UTSW 1 66,646,451 (GRCm38) missense possibly damaging 0.85
Z1176:Unc80 UTSW 1 66,694,409 (GRCm38) missense probably benign
Z1177:Unc80 UTSW 1 66,695,339 (GRCm38) missense probably benign 0.03
Z1177:Unc80 UTSW 1 66,646,398 (GRCm38) missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- TTAGGCTGGATCATGCTGCCCTTG -3'
(R):5'- GCCAAAGGTTCTACCCATGCAAAAG -3'

Sequencing Primer
(F):5'- GCCTGCTGTCAGTGTAATCATC -3'
(R):5'- GTTACCAACCAAGTTTTAGGCACAG -3'
Posted On 2014-05-09