Mutagenetix > Incidental Mutations

Incidental Mutation 'R1680:Tfcp2l1'

188383

Institutional Source

Beutler Lab

Gene Symbol

Tfcp2l1

Ensembl Gene

ENSMUSG00000026380

Gene Name

transcription factor CP2-like 1

Synonyms

LBP-9, 4932442M07Rik, Crtr-1, 1810030F05Rik, D930018N21Rik, Cp2l1, Tcfcp2l1

MMRRC Submission

039716-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.439) question?

Stock #

R1680 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

118627945-118685168 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 118675605 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 458 (F458I)

Ref Sequence

ENSEMBL: ENSMUSP00000027629 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027629]

Predicted Effect

probably damaging
Transcript: ENSMUST00000027629
AA Change: F458I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000027629
Gene: ENSMUSG00000026380
AA Change: F458I

Domain	Start	End	E-Value	Type
Pfam:CP2	27	240	2e-58	PFAM
low complexity region	377	390	N/A	INTRINSIC
low complexity region	406	416	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.4%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for either a knock-out or a gene-trapped allele display a phenotype characterized by postnatal growth retardation, renal hypoplasia, impaired maturation of the ducts in the salivary gland and kidney, abnormal composition of saliva and urine, and postnatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017N19Rik	C	G	10: 100,603,528	P187R	probably damaging	Het
Ahnak	T	A	19: 9,009,963	H2870Q	probably benign	Het
Arhgef33	C	T	17: 80,347,651	S95F	probably damaging	Het
Atp1a2	T	A	1: 172,278,954	D827V	probably damaging	Het
Bcat1	T	G	6: 145,039,628	D96A	probably damaging	Het
Birc6	A	T	17: 74,548,746	I184L	probably benign	Het
Ccdc129	C	T	6: 55,968,766	T824I	probably damaging	Het
Clca3b	A	T	3: 144,837,824	L415M	probably damaging	Het
Clstn1	T	C	4: 149,643,726	V617A	probably benign	Het
Col22a1	G	A	15: 71,799,361	A1050V	unknown	Het
Col5a3	C	T	9: 20,784,668		probably null	Het
Csmd3	G	A	15: 47,741,170	T1059I	probably damaging	Het
Dclk2	C	T	3: 86,805,639	R503Q	possibly damaging	Het
Dnm3	A	G	1: 162,010,976	V272A	probably benign	Het
Dnmt3a	A	G	12: 3,873,361	Q187R	probably damaging	Het
Dpp9	A	G	17: 56,190,103	Y710H	probably benign	Het
Eef1a2	A	T	2: 181,152,941	M155K	possibly damaging	Het
Entpd8	G	A	2: 25,084,024	C331Y	probably damaging	Het
Erc1	A	C	6: 119,575,761	L1072R	probably damaging	Het
Fam160b2	T	C	14: 70,586,851	Y482C	probably damaging	Het
Gtf3c2	A	G	5: 31,173,868	S155P	probably damaging	Het
Gucy2c	A	G	6: 136,722,493	S617P	probably damaging	Het
Ice1	T	C	13: 70,605,448	R840G	probably benign	Het
Il1rl2	T	C	1: 40,351,793	Y299H	possibly damaging	Het
Ints7	T	G	1: 191,621,162		probably null	Het
Ireb2	C	T	9: 54,881,518	T92I	probably damaging	Het
Kcnj8	A	T	6: 142,570,189	L64*	probably null	Het
Mapk8ip3	A	G	17: 24,901,011	V983A	probably damaging	Het
Mertk	A	G	2: 128,801,636	D985G	probably benign	Het
Mical3	A	T	6: 120,959,643	S1307R	probably benign	Het
Ncaph2	A	G	15: 89,364,622	D222G	probably benign	Het
Nf1	C	A	11: 79,550,998	S295*	probably null	Het
Nlrp12	T	A	7: 3,241,174	D236V	probably damaging	Het
Npnt	A	G	3: 132,906,802	V74A	probably benign	Het
Oasl1	A	G	5: 114,935,944	D304G	probably damaging	Het
Olfr1098	C	T	2: 86,923,161	V124I	probably benign	Het
Olfr556	A	G	7: 102,670,733	D271G	possibly damaging	Het
Olfr834	A	G	9: 18,988,516	H176R	possibly damaging	Het
Olfr936	T	C	9: 39,047,000	I140V	probably benign	Het
Patz1	A	G	11: 3,307,812	K604E	probably damaging	Het
Pcsk6	T	A	7: 66,035,250	V793E	probably benign	Het
Pla2g4d	C	T	2: 120,277,750		probably null	Het
Plxnc1	A	C	10: 94,841,551	L938R	probably benign	Het
Pou4f2	G	T	8: 78,434,831	A381D	probably damaging	Het
Prdm4	A	G	10: 85,899,223	L685P	possibly damaging	Het
Pxn	T	A	5: 115,552,147	V383E	probably damaging	Het
Rbl1	A	G	2: 157,174,783	L632P	probably damaging	Het
Rnf135	T	A	11: 80,196,881	S219T	possibly damaging	Het
Sdk2	T	C	11: 113,791,436	D2039G	possibly damaging	Het
Sdk2	C	T	11: 113,838,646		silent	Het
Slc5a6	A	G	5: 31,042,644	Y131H	probably damaging	Het
Slc9a1	T	C	4: 133,418,080	I492T	probably damaging	Het
Soga3	A	T	10: 29,196,839	Q709L	probably damaging	Het
Spag5	A	G	11: 78,320,616	K993E	probably damaging	Het
Sptbn1	T	G	11: 30,159,371	I75L	possibly damaging	Het
Syngap1	T	C	17: 26,952,579	S46P	possibly damaging	Het
Tmem67	A	G	4: 12,087,840	V102A	probably benign	Het
Tomm70a	T	C	16: 57,121,961	S34P	unknown	Het
Txlnb	G	T	10: 17,843,233	G604V	probably benign	Het
Ube2q1	A	G	3: 89,776,176	T143A	probably benign	Het
Unc80	C	T	1: 66,503,669	R361*	probably null	Het
Vcan	T	C	13: 89,703,547	D1098G	probably benign	Het
Vmn1r176	T	A	7: 23,835,381	T116S	probably damaging	Het
Wdr81	C	T	11: 75,454,423	R6K	probably benign	Het
Zan	T	A	5: 137,403,050	T4136S	unknown	Het
Zbtb14	C	A	17: 69,388,502	F398L	probably damaging	Het
Zfp606	A	T	7: 12,493,971	H615L	probably damaging	Het
Zp3r	A	T	1: 130,582,880	N433K	probably benign	Het

Other mutations in Tfcp2l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01079:Tfcp2l1	APN	1	118652882	missense	possibly damaging	0.70
IGL01725:Tfcp2l1	APN	1	118668636	missense	possibly damaging	0.80
IGL02281:Tfcp2l1	APN	1	118669380	splice site	probably benign
R1272:Tfcp2l1	UTSW	1	118632313	missense	probably damaging	1.00
R1959:Tfcp2l1	UTSW	1	118669389	missense	probably benign	0.40
R1965:Tfcp2l1	UTSW	1	118652923	nonsense	probably null
R3928:Tfcp2l1	UTSW	1	118669476	missense	possibly damaging	0.92
R4236:Tfcp2l1	UTSW	1	118662065	missense	probably benign	0.44
R4678:Tfcp2l1	UTSW	1	118668648	missense	probably benign	0.33
R4839:Tfcp2l1	UTSW	1	118669464	missense	probably benign	0.00
R4858:Tfcp2l1	UTSW	1	118669509	missense	possibly damaging	0.62
R5587:Tfcp2l1	UTSW	1	118664762	missense	possibly damaging	0.59
R5679:Tfcp2l1	UTSW	1	118668647	missense	probably benign
R6899:Tfcp2l1	UTSW	1	118675575	missense	probably benign
R7010:Tfcp2l1	UTSW	1	118653727	missense	probably damaging	1.00
R7155:Tfcp2l1	UTSW	1	118668632	missense	probably damaging	1.00
R7494:Tfcp2l1	UTSW	1	118664956	missense	probably damaging	1.00
R7849:Tfcp2l1	UTSW	1	118675595	missense	probably damaging	1.00
R7932:Tfcp2l1	UTSW	1	118675595	missense	probably damaging	1.00
R7993:Tfcp2l1	UTSW	1	118666103	splice site	probably null
Z1177:Tfcp2l1	UTSW	1	118656498	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GAGACCCTGAATGGTGTCTTTCTGG -3'
(R):5'- TCATTGTGGCATCTGGCTCATCTG -3'

Sequencing Primer
(F):5'- gtgcctcctgtctgctc -3'
(R):5'- ACTTGGGCTTCCCAGAAACTG -3'

Posted On

2014-05-09