Incidental Mutation 'R1680:Zp3r'
ID 188384
Institutional Source Beutler Lab
Gene Symbol Zp3r
Ensembl Gene ENSMUSG00000042554
Gene Name zona pellucida 3 receptor
Synonyms SP56
MMRRC Submission 039716-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock # R1680 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 130576713-130629621 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 130582880 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 433 (N433K)
Ref Sequence ENSEMBL: ENSMUSP00000045443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039862] [ENSMUST00000128128] [ENSMUST00000142416]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000039862
AA Change: N433K

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000045443
Gene: ENSMUSG00000042554
AA Change: N433K

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
CCP 34 91 2.52e-7 SMART
CCP 96 153 3.17e-13 SMART
CCP 158 218 8.23e-12 SMART
CCP 223 278 1.77e-11 SMART
CCP 283 345 5.32e-6 SMART
CCP 350 411 3.67e-9 SMART
CCP 456 509 6.95e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128128
AA Change: N389K

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000114401
Gene: ENSMUSG00000042554
AA Change: N389K

DomainStartEndE-ValueType
CCP 55 112 2.52e-7 SMART
CCP 117 174 3.17e-13 SMART
CCP 179 234 1.77e-11 SMART
CCP 239 301 5.32e-6 SMART
CCP 306 367 3.67e-9 SMART
CCP 412 465 6.95e-10 SMART
PDB:4B0F|G 468 513 8e-8 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000142416
AA Change: N368K

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000118784
Gene: ENSMUSG00000042554
AA Change: N368K

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
CCP 34 91 2.52e-7 SMART
CCP 96 153 3.17e-13 SMART
CCP 158 213 1.77e-11 SMART
CCP 218 280 5.32e-6 SMART
CCP 285 346 3.67e-9 SMART
CCP 391 444 6.95e-10 SMART
PDB:4B0F|G 447 492 8e-8 PDB
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal fertility and sperm morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik C G 10: 100,603,528 P187R probably damaging Het
Ahnak T A 19: 9,009,963 H2870Q probably benign Het
Arhgef33 C T 17: 80,347,651 S95F probably damaging Het
Atp1a2 T A 1: 172,278,954 D827V probably damaging Het
Bcat1 T G 6: 145,039,628 D96A probably damaging Het
Birc6 A T 17: 74,548,746 I184L probably benign Het
Ccdc129 C T 6: 55,968,766 T824I probably damaging Het
Clca3b A T 3: 144,837,824 L415M probably damaging Het
Clstn1 T C 4: 149,643,726 V617A probably benign Het
Col22a1 G A 15: 71,799,361 A1050V unknown Het
Col5a3 C T 9: 20,784,668 probably null Het
Csmd3 G A 15: 47,741,170 T1059I probably damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dnm3 A G 1: 162,010,976 V272A probably benign Het
Dnmt3a A G 12: 3,873,361 Q187R probably damaging Het
Dpp9 A G 17: 56,190,103 Y710H probably benign Het
Eef1a2 A T 2: 181,152,941 M155K possibly damaging Het
Entpd8 G A 2: 25,084,024 C331Y probably damaging Het
Erc1 A C 6: 119,575,761 L1072R probably damaging Het
Fam160b2 T C 14: 70,586,851 Y482C probably damaging Het
Gtf3c2 A G 5: 31,173,868 S155P probably damaging Het
Gucy2c A G 6: 136,722,493 S617P probably damaging Het
Ice1 T C 13: 70,605,448 R840G probably benign Het
Il1rl2 T C 1: 40,351,793 Y299H possibly damaging Het
Ints7 T G 1: 191,621,162 probably null Het
Ireb2 C T 9: 54,881,518 T92I probably damaging Het
Kcnj8 A T 6: 142,570,189 L64* probably null Het
Mapk8ip3 A G 17: 24,901,011 V983A probably damaging Het
Mertk A G 2: 128,801,636 D985G probably benign Het
Mical3 A T 6: 120,959,643 S1307R probably benign Het
Ncaph2 A G 15: 89,364,622 D222G probably benign Het
Nf1 C A 11: 79,550,998 S295* probably null Het
Nlrp12 T A 7: 3,241,174 D236V probably damaging Het
Npnt A G 3: 132,906,802 V74A probably benign Het
Oasl1 A G 5: 114,935,944 D304G probably damaging Het
Olfr1098 C T 2: 86,923,161 V124I probably benign Het
Olfr556 A G 7: 102,670,733 D271G possibly damaging Het
Olfr834 A G 9: 18,988,516 H176R possibly damaging Het
Olfr936 T C 9: 39,047,000 I140V probably benign Het
Patz1 A G 11: 3,307,812 K604E probably damaging Het
Pcsk6 T A 7: 66,035,250 V793E probably benign Het
Pla2g4d C T 2: 120,277,750 probably null Het
Plxnc1 A C 10: 94,841,551 L938R probably benign Het
Pou4f2 G T 8: 78,434,831 A381D probably damaging Het
Prdm4 A G 10: 85,899,223 L685P possibly damaging Het
Pxn T A 5: 115,552,147 V383E probably damaging Het
Rbl1 A G 2: 157,174,783 L632P probably damaging Het
Rnf135 T A 11: 80,196,881 S219T possibly damaging Het
Sdk2 T C 11: 113,791,436 D2039G possibly damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Slc5a6 A G 5: 31,042,644 Y131H probably damaging Het
Slc9a1 T C 4: 133,418,080 I492T probably damaging Het
Soga3 A T 10: 29,196,839 Q709L probably damaging Het
Spag5 A G 11: 78,320,616 K993E probably damaging Het
Sptbn1 T G 11: 30,159,371 I75L possibly damaging Het
Syngap1 T C 17: 26,952,579 S46P possibly damaging Het
Tfcp2l1 T A 1: 118,675,605 F458I probably damaging Het
Tmem67 A G 4: 12,087,840 V102A probably benign Het
Tomm70a T C 16: 57,121,961 S34P unknown Het
Txlnb G T 10: 17,843,233 G604V probably benign Het
Ube2q1 A G 3: 89,776,176 T143A probably benign Het
Unc80 C T 1: 66,503,669 R361* probably null Het
Vcan T C 13: 89,703,547 D1098G probably benign Het
Vmn1r176 T A 7: 23,835,381 T116S probably damaging Het
Wdr81 C T 11: 75,454,423 R6K probably benign Het
Zan T A 5: 137,403,050 T4136S unknown Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp606 A T 7: 12,493,971 H615L probably damaging Het
Other mutations in Zp3r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01352:Zp3r APN 1 130619356 missense possibly damaging 0.88
IGL01783:Zp3r APN 1 130598866 missense possibly damaging 0.72
IGL01820:Zp3r APN 1 130598920 missense probably benign 0.01
IGL01959:Zp3r APN 1 130591451 nonsense probably null
IGL01978:Zp3r APN 1 130598941 missense probably damaging 1.00
IGL02232:Zp3r APN 1 130596667 missense probably damaging 1.00
IGL02290:Zp3r APN 1 130619365 missense possibly damaging 0.89
IGL02878:Zp3r APN 1 130582851 missense probably benign 0.02
IGL02960:Zp3r APN 1 130583438 missense possibly damaging 0.67
BB006:Zp3r UTSW 1 130591480 missense probably benign 0.31
BB016:Zp3r UTSW 1 130591480 missense probably benign 0.31
PIT4403001:Zp3r UTSW 1 130582872 missense possibly damaging 0.93
R0433:Zp3r UTSW 1 130577133 splice site probably benign
R0491:Zp3r UTSW 1 130618334 missense probably damaging 1.00
R0781:Zp3r UTSW 1 130577884 critical splice donor site probably null
R1110:Zp3r UTSW 1 130577884 critical splice donor site probably null
R1126:Zp3r UTSW 1 130618342 missense probably damaging 1.00
R1295:Zp3r UTSW 1 130591444 missense probably damaging 1.00
R1728:Zp3r UTSW 1 130596814 missense probably benign 0.00
R1728:Zp3r UTSW 1 130619414 missense possibly damaging 0.68
R1729:Zp3r UTSW 1 130596814 missense probably benign 0.00
R1729:Zp3r UTSW 1 130619414 missense possibly damaging 0.68
R1730:Zp3r UTSW 1 130596814 missense probably benign 0.00
R1730:Zp3r UTSW 1 130619414 missense possibly damaging 0.68
R1739:Zp3r UTSW 1 130596814 missense probably benign 0.00
R1739:Zp3r UTSW 1 130619414 missense possibly damaging 0.68
R1762:Zp3r UTSW 1 130596814 missense probably benign 0.00
R1762:Zp3r UTSW 1 130619414 missense possibly damaging 0.68
R1783:Zp3r UTSW 1 130596814 missense probably benign 0.00
R1783:Zp3r UTSW 1 130619414 missense possibly damaging 0.68
R1784:Zp3r UTSW 1 130596814 missense probably benign 0.00
R1784:Zp3r UTSW 1 130619414 missense possibly damaging 0.68
R1785:Zp3r UTSW 1 130596814 missense probably benign 0.00
R1785:Zp3r UTSW 1 130619414 missense possibly damaging 0.68
R3942:Zp3r UTSW 1 130577054 missense possibly damaging 0.94
R4429:Zp3r UTSW 1 130591391 missense possibly damaging 0.95
R4571:Zp3r UTSW 1 130578020 missense probably damaging 1.00
R4626:Zp3r UTSW 1 130615175 missense probably damaging 1.00
R4647:Zp3r UTSW 1 130577960 missense probably damaging 1.00
R4790:Zp3r UTSW 1 130582892 missense probably damaging 1.00
R4815:Zp3r UTSW 1 130598912 missense probably damaging 1.00
R5355:Zp3r UTSW 1 130596781 missense probably benign 0.09
R5554:Zp3r UTSW 1 130583471 missense probably benign 0.42
R5629:Zp3r UTSW 1 130582879 missense probably damaging 0.99
R6154:Zp3r UTSW 1 130598905 missense probably damaging 1.00
R6173:Zp3r UTSW 1 130591568 splice site probably null
R6949:Zp3r UTSW 1 130577895 missense probably benign 0.00
R7346:Zp3r UTSW 1 130583480 missense probably benign 0.02
R7399:Zp3r UTSW 1 130577053 missense probably damaging 0.98
R7929:Zp3r UTSW 1 130591480 missense probably benign 0.31
R7944:Zp3r UTSW 1 130596823 missense probably damaging 1.00
R7945:Zp3r UTSW 1 130596823 missense probably damaging 1.00
R8367:Zp3r UTSW 1 130598873 missense probably damaging 1.00
R8742:Zp3r UTSW 1 130583493 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAAGCTATGCAAGTGCTGACTG -3'
(R):5'- AGCTTTTGCCAGGGGACATAACAC -3'

Sequencing Primer
(F):5'- CCTCAGAGCAGAGATAAGTAACTTC -3'
(R):5'- TATTTGTCCATCCAGGGGGAAAG -3'
Posted On 2014-05-09