Incidental Mutation 'R1680:Ints7'
ID188387
Institutional Source Beutler Lab
Gene Symbol Ints7
Ensembl Gene ENSMUSG00000037461
Gene Nameintegrator complex subunit 7
Synonyms5930412E23Rik
MMRRC Submission 039716-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R1680 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location191575636-191623688 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to G at 191621162 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000036277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045450] [ENSMUST00000194785] [ENSMUST00000194877]
Predicted Effect probably null
Transcript: ENSMUST00000045450
SMART Domains Protein: ENSMUSP00000036277
Gene: ENSMUSG00000037461

DomainStartEndE-ValueType
SCOP:d1gw5a_ 76 530 1e-10 SMART
low complexity region 937 960 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194785
Predicted Effect probably benign
Transcript: ENSMUST00000194877
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the integrator complex. The integrator complex associates with the C-terminal domain of RNA polymerase II and mediates 3'-end processing of the small nuclear RNAs U1 and U2. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik C G 10: 100,603,528 P187R probably damaging Het
Ahnak T A 19: 9,009,963 H2870Q probably benign Het
Arhgef33 C T 17: 80,347,651 S95F probably damaging Het
Atp1a2 T A 1: 172,278,954 D827V probably damaging Het
Bcat1 T G 6: 145,039,628 D96A probably damaging Het
Birc6 A T 17: 74,548,746 I184L probably benign Het
Ccdc129 C T 6: 55,968,766 T824I probably damaging Het
Clca3b A T 3: 144,837,824 L415M probably damaging Het
Clstn1 T C 4: 149,643,726 V617A probably benign Het
Col22a1 G A 15: 71,799,361 A1050V unknown Het
Col5a3 C T 9: 20,784,668 probably null Het
Csmd3 G A 15: 47,741,170 T1059I probably damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dnm3 A G 1: 162,010,976 V272A probably benign Het
Dnmt3a A G 12: 3,873,361 Q187R probably damaging Het
Dpp9 A G 17: 56,190,103 Y710H probably benign Het
Eef1a2 A T 2: 181,152,941 M155K possibly damaging Het
Entpd8 G A 2: 25,084,024 C331Y probably damaging Het
Erc1 A C 6: 119,575,761 L1072R probably damaging Het
Fam160b2 T C 14: 70,586,851 Y482C probably damaging Het
Gtf3c2 A G 5: 31,173,868 S155P probably damaging Het
Gucy2c A G 6: 136,722,493 S617P probably damaging Het
Ice1 T C 13: 70,605,448 R840G probably benign Het
Il1rl2 T C 1: 40,351,793 Y299H possibly damaging Het
Ireb2 C T 9: 54,881,518 T92I probably damaging Het
Kcnj8 A T 6: 142,570,189 L64* probably null Het
Mapk8ip3 A G 17: 24,901,011 V983A probably damaging Het
Mertk A G 2: 128,801,636 D985G probably benign Het
Mical3 A T 6: 120,959,643 S1307R probably benign Het
Ncaph2 A G 15: 89,364,622 D222G probably benign Het
Nf1 C A 11: 79,550,998 S295* probably null Het
Nlrp12 T A 7: 3,241,174 D236V probably damaging Het
Npnt A G 3: 132,906,802 V74A probably benign Het
Oasl1 A G 5: 114,935,944 D304G probably damaging Het
Olfr1098 C T 2: 86,923,161 V124I probably benign Het
Olfr556 A G 7: 102,670,733 D271G possibly damaging Het
Olfr834 A G 9: 18,988,516 H176R possibly damaging Het
Olfr936 T C 9: 39,047,000 I140V probably benign Het
Patz1 A G 11: 3,307,812 K604E probably damaging Het
Pcsk6 T A 7: 66,035,250 V793E probably benign Het
Pla2g4d C T 2: 120,277,750 probably null Het
Plxnc1 A C 10: 94,841,551 L938R probably benign Het
Pou4f2 G T 8: 78,434,831 A381D probably damaging Het
Prdm4 A G 10: 85,899,223 L685P possibly damaging Het
Pxn T A 5: 115,552,147 V383E probably damaging Het
Rbl1 A G 2: 157,174,783 L632P probably damaging Het
Rnf135 T A 11: 80,196,881 S219T possibly damaging Het
Sdk2 T C 11: 113,791,436 D2039G possibly damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Slc5a6 A G 5: 31,042,644 Y131H probably damaging Het
Slc9a1 T C 4: 133,418,080 I492T probably damaging Het
Soga3 A T 10: 29,196,839 Q709L probably damaging Het
Spag5 A G 11: 78,320,616 K993E probably damaging Het
Sptbn1 T G 11: 30,159,371 I75L possibly damaging Het
Syngap1 T C 17: 26,952,579 S46P possibly damaging Het
Tfcp2l1 T A 1: 118,675,605 F458I probably damaging Het
Tmem67 A G 4: 12,087,840 V102A probably benign Het
Tomm70a T C 16: 57,121,961 S34P unknown Het
Txlnb G T 10: 17,843,233 G604V probably benign Het
Ube2q1 A G 3: 89,776,176 T143A probably benign Het
Unc80 C T 1: 66,503,669 R361* probably null Het
Vcan T C 13: 89,703,547 D1098G probably benign Het
Vmn1r176 T A 7: 23,835,381 T116S probably damaging Het
Wdr81 C T 11: 75,454,423 R6K probably benign Het
Zan T A 5: 137,403,050 T4136S unknown Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp606 A T 7: 12,493,971 H615L probably damaging Het
Zp3r A T 1: 130,582,880 N433K probably benign Het
Other mutations in Ints7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Ints7 APN 1 191596164 splice site probably null
IGL01285:Ints7 APN 1 191615778 missense probably benign 0.00
IGL01289:Ints7 APN 1 191615778 missense probably benign 0.00
IGL01572:Ints7 APN 1 191615793 missense possibly damaging 0.71
IGL01665:Ints7 APN 1 191613219 splice site probably benign
IGL02059:Ints7 APN 1 191615760 missense probably benign 0.23
IGL02684:Ints7 APN 1 191613637 critical splice acceptor site probably null
IGL02686:Ints7 APN 1 191586592 missense probably damaging 1.00
IGL02812:Ints7 APN 1 191619741 missense probably damaging 1.00
IGL03119:Ints7 APN 1 191610365 missense probably damaging 1.00
IGL03162:Ints7 APN 1 191621412 utr 3 prime probably benign
PIT4810001:Ints7 UTSW 1 191596236 missense probably damaging 0.99
R0294:Ints7 UTSW 1 191611891 missense possibly damaging 0.91
R0479:Ints7 UTSW 1 191614554 intron probably null
R0698:Ints7 UTSW 1 191594464 missense probably damaging 0.97
R1420:Ints7 UTSW 1 191613057 missense possibly damaging 0.73
R1781:Ints7 UTSW 1 191596284 missense possibly damaging 0.95
R2141:Ints7 UTSW 1 191604860 missense possibly damaging 0.73
R2291:Ints7 UTSW 1 191606203 synonymous probably null
R4718:Ints7 UTSW 1 191583277 missense possibly damaging 0.60
R4741:Ints7 UTSW 1 191619635 missense probably benign 0.29
R4797:Ints7 UTSW 1 191596933 missense probably damaging 1.00
R4812:Ints7 UTSW 1 191594430 missense possibly damaging 0.73
R4826:Ints7 UTSW 1 191611906 missense probably damaging 0.97
R4870:Ints7 UTSW 1 191596331 missense probably damaging 0.97
R5169:Ints7 UTSW 1 191613090 missense probably benign 0.00
R5281:Ints7 UTSW 1 191615771 missense possibly damaging 0.90
R5694:Ints7 UTSW 1 191586618 missense probably damaging 1.00
R5752:Ints7 UTSW 1 191575893 missense probably benign 0.00
R6048:Ints7 UTSW 1 191621412 utr 3 prime probably benign
R6341:Ints7 UTSW 1 191613127 missense probably damaging 1.00
R6419:Ints7 UTSW 1 191602302 missense possibly damaging 0.69
R7037:Ints7 UTSW 1 191619605 missense probably benign 0.16
R7163:Ints7 UTSW 1 191617837 missense possibly damaging 0.67
R7603:Ints7 UTSW 1 191596224 missense probably damaging 1.00
R7801:Ints7 UTSW 1 191615747 missense possibly damaging 0.84
R7899:Ints7 UTSW 1 191621315 missense probably damaging 1.00
R7982:Ints7 UTSW 1 191621315 missense probably damaging 1.00
R8034:Ints7 UTSW 1 191613068 frame shift probably null
R8034:Ints7 UTSW 1 191613071 frame shift probably null
Z1177:Ints7 UTSW 1 191610458 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AAACGGTGGGCTGTGTCTAGAAC -3'
(R):5'- TGCACATGCGGAAGACTCTTCTTG -3'

Sequencing Primer
(F):5'- GGCTGTGTCTAGAACACTCC -3'
(R):5'- GGTCTTCCAGGGATTTGACAAAC -3'
Posted On2014-05-09