Mutagenetix > Incidental Mutations

Incidental Mutation 'R1680:Mertk'

188391

Institutional Source

Beutler Lab

Gene Symbol

Mertk

Ensembl Gene

ENSMUSG00000014361

Gene Name

c-mer proto-oncogene tyrosine kinase

Synonyms

Nyk, nmf12, Tyro 12, Eyk, Mer

MMRRC Submission

039716-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.146) question?

Stock #

R1680 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

128698956-128802894 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 128801636 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 985 (D985G)

Ref Sequence

ENSEMBL: ENSMUSP00000014505 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014505]

Predicted Effect

probably benign
Transcript: ENSMUST00000014505
AA Change: D985G

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000014505
Gene: ENSMUSG00000014361
AA Change: D985G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
IG	94	189	8.99e-6	SMART
IG	198	276	1.54e-4	SMART
FN3	279	363	7.23e-8	SMART
FN3	379	465	6.16e-2	SMART
transmembrane domain	498	520	N/A	INTRINSIC
TyrKc	582	849	2.88e-129	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140221

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the MER/AXL/TYRO3 receptor kinase family and encodes a transmembrane protein with two fibronectin type-III domains, two Ig-like C2-type (immunoglobulin-like) domains, and one tyrosine kinase domain. Mutations in this gene have been associated with disruption of the retinal pigment epithelium (RPE) phagocytosis pathway and onset of autosomal recessive retinitis pigmentosa (RP). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations show increased sensitivity to LPS-induced shock, defective phagocytosis of apoptotic cells, lupus-like autoimmunity, degeneration of photoreceptors, decreased platelet aggregation and protection from induced pulmonary thromboembolism and thrombosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017N19Rik	C	G	10: 100,603,528	P187R	probably damaging	Het
Ahnak	T	A	19: 9,009,963	H2870Q	probably benign	Het
Arhgef33	C	T	17: 80,347,651	S95F	probably damaging	Het
Atp1a2	T	A	1: 172,278,954	D827V	probably damaging	Het
Bcat1	T	G	6: 145,039,628	D96A	probably damaging	Het
Birc6	A	T	17: 74,548,746	I184L	probably benign	Het
Ccdc129	C	T	6: 55,968,766	T824I	probably damaging	Het
Clca3b	A	T	3: 144,837,824	L415M	probably damaging	Het
Clstn1	T	C	4: 149,643,726	V617A	probably benign	Het
Col22a1	G	A	15: 71,799,361	A1050V	unknown	Het
Col5a3	C	T	9: 20,784,668		probably null	Het
Csmd3	G	A	15: 47,741,170	T1059I	probably damaging	Het
Dclk2	C	T	3: 86,805,639	R503Q	possibly damaging	Het
Dnm3	A	G	1: 162,010,976	V272A	probably benign	Het
Dnmt3a	A	G	12: 3,873,361	Q187R	probably damaging	Het
Dpp9	A	G	17: 56,190,103	Y710H	probably benign	Het
Eef1a2	A	T	2: 181,152,941	M155K	possibly damaging	Het
Entpd8	G	A	2: 25,084,024	C331Y	probably damaging	Het
Erc1	A	C	6: 119,575,761	L1072R	probably damaging	Het
Fam160b2	T	C	14: 70,586,851	Y482C	probably damaging	Het
Gtf3c2	A	G	5: 31,173,868	S155P	probably damaging	Het
Gucy2c	A	G	6: 136,722,493	S617P	probably damaging	Het
Ice1	T	C	13: 70,605,448	R840G	probably benign	Het
Il1rl2	T	C	1: 40,351,793	Y299H	possibly damaging	Het
Ints7	T	G	1: 191,621,162		probably null	Het
Ireb2	C	T	9: 54,881,518	T92I	probably damaging	Het
Kcnj8	A	T	6: 142,570,189	L64*	probably null	Het
Mapk8ip3	A	G	17: 24,901,011	V983A	probably damaging	Het
Mical3	A	T	6: 120,959,643	S1307R	probably benign	Het
Ncaph2	A	G	15: 89,364,622	D222G	probably benign	Het
Nf1	C	A	11: 79,550,998	S295*	probably null	Het
Nlrp12	T	A	7: 3,241,174	D236V	probably damaging	Het
Npnt	A	G	3: 132,906,802	V74A	probably benign	Het
Oasl1	A	G	5: 114,935,944	D304G	probably damaging	Het
Olfr1098	C	T	2: 86,923,161	V124I	probably benign	Het
Olfr556	A	G	7: 102,670,733	D271G	possibly damaging	Het
Olfr834	A	G	9: 18,988,516	H176R	possibly damaging	Het
Olfr936	T	C	9: 39,047,000	I140V	probably benign	Het
Patz1	A	G	11: 3,307,812	K604E	probably damaging	Het
Pcsk6	T	A	7: 66,035,250	V793E	probably benign	Het
Pla2g4d	C	T	2: 120,277,750		probably null	Het
Plxnc1	A	C	10: 94,841,551	L938R	probably benign	Het
Pou4f2	G	T	8: 78,434,831	A381D	probably damaging	Het
Prdm4	A	G	10: 85,899,223	L685P	possibly damaging	Het
Pxn	T	A	5: 115,552,147	V383E	probably damaging	Het
Rbl1	A	G	2: 157,174,783	L632P	probably damaging	Het
Rnf135	T	A	11: 80,196,881	S219T	possibly damaging	Het
Sdk2	T	C	11: 113,791,436	D2039G	possibly damaging	Het
Sdk2	C	T	11: 113,838,646		silent	Het
Slc5a6	A	G	5: 31,042,644	Y131H	probably damaging	Het
Slc9a1	T	C	4: 133,418,080	I492T	probably damaging	Het
Soga3	A	T	10: 29,196,839	Q709L	probably damaging	Het
Spag5	A	G	11: 78,320,616	K993E	probably damaging	Het
Sptbn1	T	G	11: 30,159,371	I75L	possibly damaging	Het
Syngap1	T	C	17: 26,952,579	S46P	possibly damaging	Het
Tfcp2l1	T	A	1: 118,675,605	F458I	probably damaging	Het
Tmem67	A	G	4: 12,087,840	V102A	probably benign	Het
Tomm70a	T	C	16: 57,121,961	S34P	unknown	Het
Txlnb	G	T	10: 17,843,233	G604V	probably benign	Het
Ube2q1	A	G	3: 89,776,176	T143A	probably benign	Het
Unc80	C	T	1: 66,503,669	R361*	probably null	Het
Vcan	T	C	13: 89,703,547	D1098G	probably benign	Het
Vmn1r176	T	A	7: 23,835,381	T116S	probably damaging	Het
Wdr81	C	T	11: 75,454,423	R6K	probably benign	Het
Zan	T	A	5: 137,403,050	T4136S	unknown	Het
Zbtb14	C	A	17: 69,388,502	F398L	probably damaging	Het
Zfp606	A	T	7: 12,493,971	H615L	probably damaging	Het
Zp3r	A	T	1: 130,582,880	N433K	probably benign	Het

Other mutations in Mertk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01540:Mertk	APN	2	128783967	missense	probably damaging	1.00
IGL01561:Mertk	APN	2	128736636	missense	probably damaging	1.00
IGL01873:Mertk	APN	2	128729275	missense	possibly damaging	0.93
IGL02539:Mertk	APN	2	128801290	missense	probably damaging	1.00
IGL02652:Mertk	APN	2	128801270	missense	probably benign
IGL02962:Mertk	APN	2	128777454	missense	probably damaging	1.00
IGL03237:Mertk	APN	2	128790272	missense	probably damaging	1.00
PIT4378001:Mertk	UTSW	2	128782617	critical splice donor site	probably null
R0118:Mertk	UTSW	2	128759166	missense	probably damaging	0.99
R0281:Mertk	UTSW	2	128782621	splice site	probably benign
R0491:Mertk	UTSW	2	128793107	critical splice donor site	probably null
R0565:Mertk	UTSW	2	128771483	missense	probably benign	0.20
R0628:Mertk	UTSW	2	128738313	missense	probably damaging	1.00
R1260:Mertk	UTSW	2	128762152	missense	probably benign	0.03
R1406:Mertk	UTSW	2	128771486	missense	probably benign	0.00
R1406:Mertk	UTSW	2	128771486	missense	probably benign	0.00
R1423:Mertk	UTSW	2	128778963	missense	probably damaging	1.00
R1523:Mertk	UTSW	2	128790328	critical splice donor site	probably null
R1539:Mertk	UTSW	2	128782526	missense	probably benign	0.05
R1770:Mertk	UTSW	2	128750174	missense	probably benign	0.10
R1832:Mertk	UTSW	2	128762212	missense	probably benign	0.10
R1870:Mertk	UTSW	2	128801196	missense	probably benign	0.01
R1959:Mertk	UTSW	2	128759090	missense	probably damaging	0.98
R2078:Mertk	UTSW	2	128794458	missense	probably damaging	1.00
R2125:Mertk	UTSW	2	128762138	missense	probably benign
R2178:Mertk	UTSW	2	128793064	missense	probably damaging	1.00
R2220:Mertk	UTSW	2	128801472	missense	probably benign	0.18
R4128:Mertk	UTSW	2	128777438	nonsense	probably null
R4664:Mertk	UTSW	2	128801212	missense	probably benign	0.24
R4740:Mertk	UTSW	2	128751994	missense	probably damaging	1.00
R4822:Mertk	UTSW	2	128801305	missense	probably benign	0.00
R4839:Mertk	UTSW	2	128782576	missense	probably damaging	0.97
R4874:Mertk	UTSW	2	128750159	missense	probably damaging	1.00
R4899:Mertk	UTSW	2	128783925	missense	probably damaging	1.00
R5010:Mertk	UTSW	2	128784000	missense	probably benign	0.03
R5128:Mertk	UTSW	2	128738247	missense	probably damaging	0.97
R5251:Mertk	UTSW	2	128729455	missense	probably damaging	1.00
R5276:Mertk	UTSW	2	128801314	missense	possibly damaging	0.87
R5397:Mertk	UTSW	2	128771464	missense	possibly damaging	0.86
R5575:Mertk	UTSW	2	128736565	missense	probably damaging	1.00
R5605:Mertk	UTSW	2	128738307	missense	probably benign	0.43
R5705:Mertk	UTSW	2	128771401	missense	probably benign	0.00
R5987:Mertk	UTSW	2	128771374	missense	probably benign	0.01
R6127:Mertk	UTSW	2	128738291	missense	probably damaging	0.99
R6556:Mertk	UTSW	2	128776421	missense	probably benign	0.23
R6671:Mertk	UTSW	2	128752023	critical splice donor site	probably null
R6674:Mertk	UTSW	2	128729357	missense	probably benign
R6841:Mertk	UTSW	2	128759230	splice site	probably null
R7153:Mertk	UTSW	2	128736649	missense	probably damaging	0.99
R7192:Mertk	UTSW	2	128793108	splice site	probably null
R7225:Mertk	UTSW	2	128801562	missense	possibly damaging	0.94
R7344:Mertk	UTSW	2	128771497	missense	probably benign
R7414:Mertk	UTSW	2	128729393	missense	possibly damaging	0.95
R7883:Mertk	UTSW	2	128776345	missense	probably benign	0.01
R8000:Mertk	UTSW	2	128771498	missense	probably benign
X0067:Mertk	UTSW	2	128729567	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACATTGACCCTGACTCCATCATTGC -3'
(R):5'- CTGTCCGGCCATGAACTCTACTTG -3'

Sequencing Primer
(F):5'- TGGTCACGGCAGAAGTTCAC -3'
(R):5'- gctctctgtctcctgcttg -3'

Posted On

2014-05-09